Abstract

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5'GGTTTGTTTACCACCCTTGG3' (3) and PMTV2 5'AAAAGCCTGAGCGGTTAATTG3' (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production.

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.