First Report of Fusarium temperatum Causing Fruit Blotch of Capsicum pubescens in Puebla, México.

Abstract

Puebla is one of the provinces in Mexico that produces manzano pepper (Capsicum pubescens). Recently, the producers of manzano pepper from the northern highlands of Puebla reported an aggressive fruit blotch that caused severe damage and substantial economic losses. Symptoms were rot spots with mycelial growth at the center of the spot, necrosis in the periphery, a change in fruit size, loss of turgor and discoloration. The symptoms were observed at different fruit ripening stages. Around 50% of fruits of a plant (n=50) were infected. Diseased fruits were collected from March to September 2020 in Yaonáhuac Puebla, Mexico. These samples were sanitized (20% sodium hypochlorite for 20 min) and stored in humidity chambers (n=20) for 10 days at 28 °C and 70% relative humidity, to identify the causal agent of rot. Two fungal isolates were isolated and purified in potato dextrose agar (PDA) and the isolate with the less abundant mycelium was identified as Cylindrobasidium torrendii by ITS markers. C. torrendii did not exert pathogenic activity whereas the second isolate had evident pathogenic properties. Morphological identification of the causal agent was done from the monosporic cultures of the 2nd isolate developed in PDA (Tariq et al. 2018). The fungus showed white cottony mycelium, becoming pinkish-white after 10 days of incubation and it turned the culture medium to dark-violet color. Koch's postulates were conducted with 1,000 conidia inoculated in the pericarp of sanitized asymptomatic peppers by mechanical penetration using a Hamilton syringe (n=20; 28 °C and 70% relative humidity for 12 days). After 6 days, the samples inoculated with the conidia showed the same symptoms as those observed under the field conditions. Microscopic characteristics were obtained from PDA and Spezieller Nahrstoffarmer agar (SNA). The fungus showed hyaline mycelium with septate hyphae containing erect-branched conidiophores with 1 to 3 phialides. The size of macro- and microconidia (n=100) was 20.3-43.1 μm and 6.2-14.3 µm, respectively (Pintos et al. 2013). Molecular analysis were done according to the method described by Morales-Mora et al. (2019) by sequencing the translation elongation factor 1 alpha (EF-1H- ATGGGTAAGGAAGACAAGAC and EF-2T-GGAAGTACCAGTGATCATGTT) (Molnár et al. 2015; Scauflaire et al. 2011) . The amplicon (671 bp) was sequenced with the oligonucleotide EF-2T and compared with the sequences of the accessions HM067686, HM067687 (Scauflaire et al. 2011) and KT447148 (Lanza 2016) of the National Center for Biotechnological Information (NCBI), showing 100% homology with Fusarium temperatum. The partial sequence of EF-1α from F. temperatum isolated in this study, was deposited at NCBI databank with the accession MW570680. Since F. temperatum has been reported as the infective agent of maize around the world (Pintos et al.), F. temperatum causing fruit blotch can be a new threat to the producers of manzano pepper in México. The identification of this pathogen is the first, important step to develop management strategies for the control of this disease.