Abstract

The quarantine insect pest Phenacoccus solenopsis (Hemiptera: Pseudococcidae) has a broad host range and is distributed worldwide. Each year, P. solenopsis causes significant crop losses. The detoxification of various xenobiotic compounds involves the cytochrome P450 monooxygenase (CYP) superfamily of enzymes. However, the functions of CYPs in P. solenopsis are poorly understood. In the present study, P. solenopsis was reared from the egg to the adult stage on three host plants: Tomato, cotton, and hibiscus. Thirty-seven P. solenopsis CYP genes were identified and their phylogenetic relationships were analyzed. Eleven CYP genes (PsCYP4NT1, PsCYP4G219, PsCYP6PZ1, PsCYP6PZ5, PsCYP301B1, PsCYP302A1, PsCYP305A22, PsCYP315A1, PsCYP353F1, PsCYP3634A1, and PsCYP3635A2) were selected for quantitative real-time PCR analysis. The results demonstrated marked differences in CYP expression levels in P. solenopsis grown on different host plants. The results will aid the molecular characterization of CYPs and will increase our understanding of CYP expression patterns in P. solenopsis during development and growth on different hosts.

Highlights

  • Generalist herbivores feed on a variety of plants and are exposed to varied plant nutritional qualities and different secondary metabolites [1]

  • The results showed that when P. solenopsis was grown on different host plants, significant differences in cytochrome P450 monooxygenase (CYP) gene expression could be observed

  • CYP301B1 was to analyze the quantitative real-time PCR (qPCR) results of P. solenopsis in different hosts and at different ages

Read more

Summary

Introduction

Generalist herbivores feed on a variety of plants and are exposed to varied plant nutritional qualities and different secondary metabolites [1]. Plants produce certain defensive secondary substances, which are induced by insects feeding. Cytochrome P450 enzymes can regulate the adaptability of several insect herbivores to host plants [10,11]. P450s exert a variety of functions during the life cycle of insects They are involved in the metabolism of pesticides and plant secondary substances, as well as the synthesis of ecdytin, juvenile hormone, and sex pheromones, which are closely related to insect growth, development, and defense [19]. There have been many studies on the biology and ecology of P. solenopsis in its native and introduced ranges; no studies have been conducted on P. solenopsis’s cytochrome P450 gene expression after feeding on different hosts. The results showed that when P. solenopsis was grown on different host plants, significant differences in CYP gene expression could be observed. The results provided a theoretical basis for future research on P. solenopsis

Host Plants and Insects
Extraction of RNA and Preparation of RNA-Seq Libraries
Bioinformatics Analyses
Quantitative Real-Time PCR
F: CTGGTAAACACGTTCCCCGAG
Assembly and of Annotation of Unigenes
Identification of Cytochrome
Discussion
Conclusions

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.