Abstract
The wap gene encodes a single whey acidic protein (WAP) domain-containing peptide from Chinese white shrimp (Fenneropenaeus chinensis), which shows broad-spectrum antimicrobial activities and proteinase inhibitory activities in vitro. To explore the medical applications of the WAP peptide, a wap gene transgenic Drosophila melanogaster was constructed. In wap-expressing flies, high expression levels of wap gene (>100 times) were achieved, in contrast to those of control flies, by qRT-PCR analysis. The wap gene expression was associated with increased resistance to microbial infection and decreased bacterial numbers in the flies. In addition, the WAP protein extract from wap-expressing flies, compared with control protein extract from control flies, showed improved antimicrobial activities against broad Gram-positive and Gram-negative bacteria, including the clinical drug resistant bacterium of methicillin-resistant S. aureus (MRSA), improved protease inhibitor activities against crude proteinases and commercial proteinases, including elastase, subtilis proteinase A, and proteinase K in vitro, and improved growth rate and microbial resistance, as well as wound-healing in loach and mouse models. These results suggest that wap-expressing flies could be used as a food additive in aquaculture to prevent infections and a potential antibacterial for fighting drug-resistant bacteria.
Highlights
The increasing frequency of bacteria that are resistant to conventional antibiotics has led to increased infection and mortality rates and become a tremendous global public-health problem[1,2,3]
According to the constructing methods, an open reading frame (ORF) fragment of F. chinensis wap gene was inserted to pUAST vector to generate the wap/pUAST recombinant plasmid confirmed by enzyme digestion and sequencing (Supplementary Fig. S1)
F. chinensis whey acidic protein (WAP) as a novel antimicrobial agent has been verified by transgenic D. melanogaster in this study
Summary
The increasing frequency of bacteria that are resistant to conventional antibiotics has led to increased infection and mortality rates and become a tremendous global public-health problem[1,2,3]. Developing resistance against AMPs is not easy for microbial targets[11]. In addition to antimicrobial abilities, some of them display antitumor activity[18]. Based on the antimicrobial activities against a wide range of pathogens and the ability to defeat multidrug-resistant bacteria, AMPs are becoming popular as effective alternatives to current antibiotics[4,19]. It just so happens that the F. chinensis WAP recombinant protein showed broad-spectrum antimicrobial and proteinase inhibitory activities[21], which raised interest in developing WAP into a novel therapeutic agent against pathogens in clinical applications. Sequence (5′-3′) GGGGTACCATGGTGAACATCAAGGAAGTTC GCTCTTCTAGATTTTCCGTAGGGAGATCCCA CCGGAATTCATGGTGAACATCAAGGAAGTTC CCGCTCGAGTCATTTTCCGTAGGGAGATC TACGGCTGCGAGAAGACGACAGAAGGG GACCACGCGTATCGATGTCGACT16(A/C/G) CCGAGGCACTTCCTTCACTT GACCGCTTTGAGTGTTTCCG CACAACTGGCGGAACTTTGG CATTGCGCTGGAACTCGAAG ATTGCCGTCGCCTTACTTTG AATCTCGTGGCGTCCATTGT GCTCAGCCAGTTTCCGATGTG TCGTTGCAGTAGCCGCCTTG CCACCACTCCAAGCACAATG CAGCTTGAGTCAGGTGATCCT ACATCTTCGTTTTCGTCGCTC GCAGTTGCGGCGACATT ACATCTTCGTTTTCGTCGCTC GTTAACCTCGAGCAGTGGCT GCTTCAAGATGACCATCCGCCC GGTGCGCTTGTTCGATCCGTAAC CAGGCGGTGCTTTCTCTCTA AGCTGTAACCGCGCTCAGTA
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
