Abstract
We investigated the association between the expression of a gene encoding gustatory receptor (G10) and division of labor in the honey bee, Apis mellifera. Among 10 GR genes encoding proteins 15% ~ 99% amino acid identity in the honey bee, we found that AmGR10 with 99% identity is involved in nursing or brood care. Expression of AmGR10 was restricted to organs of the hypopharyngeal gland, brain, and ovary in the nurse bee phase. Members of an extended nursing caste under natural conditions continued to express this gene. RNAi knockdown of AmGR10 accelerated the transition to foraging. Our findings demonstrate that this one gene has profound effects on the division of labor associated with the development and physiology of honeybee society.
Highlights
Genetic and epigenetic studies can be fruitful in revealing the social structures of animal species
One candidate band sequence that was strongly expressed in nurse bees was used in a BLAST search of GenBank and the NCBI Honey Bee Genome (S1 Fig). 5’ and 30 RACE-PCR amplified a gene fragment of 543 bases encoding 181 amino acid residues (S2 Fig) that had 99% sequence identity to gustatory receptor (GR) 10 of A. mellifera and 50% to that of a parasitoid jewel wasp, Nasonia vitripennis (S3 Fig) [21, 22]
Candidates for 68 GRs encoded by 60 genes have been identified in D. melanogaster [24] and candidates for 76 GRs encoded by 52 genes have been found in Anopheles gambiae [25]
Summary
Genetic and epigenetic studies can be fruitful in revealing the social structures of animal species. For RT-PCR, the full-length cDNAs of 7-day-old nurse bees revers-transcribed using Ex–Taq polymerase (TaKaRa Bio) from AmGR10 mRNA were amplified using from primers (forward, 50–ATGATAGAACTCTCTAAGGC–30; reverse, 50–CGTACTTGGTGATCCTTACT–30) obtained from the NCBI Honey Bee Genome Resources. First we compared the expression of HPG mRNAs in nurse and forager bees.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
