Abstract
Listeriolysin O (LLO) is an important extracellular toxin of Listeria monocytogenes which degrades the phospholipid membranes of the host cells’ phagosomes at low pH during the intracellular survival. In contrast to the natural form, the mutant LLO carrying two replacements of amino acid E247M and D320K possesses stable activity at pH 7.4. In this study, we have constructed vectors that carry the mhlyA gene encoding double-mutated LLOE247M/D320K express in B. subtilis 1012. The target gene was fused to the sequence of LysRN-6xHis-TEV site to enhance the recombinant protein expression in B. subtilis and to ease the acquisition of protein by Ni2+-based affinity chromatography. As results, we have obtained the purified protein LLOE247M/D320K with high purity. The activity measurement with 3 HU hemolytic toxins in the pH range from 5.0 to 8.5 suggested that the activity of LLOE247M/D320K was much better than that of natural LLO at neutral pH and slightly alkaline. These results not only provided important scientific foundations for mutant LLO bases expression in B. subtilis but also supplied purified materials for researche and medical applications based on this protein.
Highlights
an important extracellular toxin of Listeria monocytogenes which degrades the phospholipid membranes of the host cells' phagosomes at low pH
The target gene was fused to the sequence of LysRN-6xHis-TEV site to enhance the recombinant protein expression
Huỳnh Thị Kim Phương được hỗ trợ bởi Đại Học Quốc gia Tp. HCM từ kinh phí nhiệm vụ thường xuyên
Summary
Listeria monocytogenes là một tác nhân gây bệnh có khả năng ký sinh nội bào một cách tùy ý. Dựa trên các nghiên cứu về cấu trúc protein, Schuerch cũng đã mô tả một số dạng đột biến ở các domain khác nhau của LLO làm thay đổi một số đặc tính quan trọng của chúng, đặc biệt là tính chất hoạt động phụ thuộc pH. Giả thuyết cho rằng cả hai dạng đột biến giúp tăng nhanh tốc độ tái sắp xếp nội phân tử để hình thành cấu trúc lỗ, nhờ đó vượt qua tác động của quá trình biến tính do pH. Dạng LLO mang hai đột biến kép (LLOE247M/D320K) được mô tả bởi Schuerch cho thấy có nhiều tiềm năng để thay thế LLOWT trong các trường hợp cần protein hoạt động trong điều kiện pH trung tính. Trình tự nucleotide 5’ – GGGAAAATGCAAGAAATGGTCATTAGTTTTAAACAAATTT ACTAT – 3’ 5’ – GTTTAAAACTAATGACCATTTCTTGCATTTTCCCTTCACTG ATTGCGCC – 3’ 5’ – CATAGTACTAAAGTAAAAGCTGCTTTTAAAGCTGCCGTAA GCGG – 3’ 5’ – CCGCTTACGGCAGCTTTAAAAGCAGCTTTTACTTTAGTAC TATG – 3’ 5’ – AAAGGAGGAAGGATCCATGAGTCAAGAAGAACATAACCA TGA – 3’ 5’ – ATGCATCCATGGATCCCTGGAAGTACAGGTTCTCACCGC – 3’
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.