Abstract
Expression and purification of full-length Alanyl-tRNA-synthetase from Thermus thermophilus HB27
Highlights
IntroductionAminoacyl-tRNA-synthetases (aaRSs) attach cognate amino acids (aa) to their tRNAs in a two-step reaction: 1) the activation of amino acid with ATP (generation of aa-AMP) and 2) the transfer of activated amino acid to the 3’-end of tRNA (formation of aminoacyl-tRNA) [1, 2]
Aminoacyl-tRNA-synthetases attach cognate amino acids to their tRNAs in a two-step reaction: 1) the activation of amino acid with ATP and 2) the transfer of activated amino acid to the 3’-end of tRNA [1, 2]
Based on the sequence information of alaS from Thermus thermophilus strain HB27 (P61707 in UniProt [25] and WP_011173855.1 in GenBank [26], 882 amino acid residues) a pair of primers was designed for PCR: 5’ forward – atatgcgcacggcggagatccgcgagaagttcc and 5’ reverse – aagcttattaggggaggaggccggggagggcctcccgg, which contained NdeI and HindIII restriction sites
Summary
Aminoacyl-tRNA-synthetases (aaRSs) attach cognate amino acids (aa) to their tRNAs in a two-step reaction: 1) the activation of amino acid with ATP (generation of aa-AMP) and 2) the transfer of activated amino acid to the 3’-end of tRNA (formation of aminoacyl-tRNA) [1, 2]. By different functional and structural features, these enzymes were divided into classes I and II [3,4,5]. Alanyl-tRNA synthetase (AlaRS) belongs to class II and consists of four domains: the N-terminal (aminoacylation domain), editing one, the domain of tRNA recognition and the.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
