Expression and Distribution of the Guanine Nucleotide-binding Protein Subunit Alpha-s in Mice Skin Tissues and Its Association with White and Black Coat Colors.

Zhihong Yin,Quanhai Pang,Shanshan Yang,Zhun Wang,Rui Bai,Xin Zhao,Min Zhao,Zhen Li

doi:10.5713/ajas.15.0711

Zhihong Yin, Quanhai Pang + Show 6 more

Open Access

https://doi.org/10.5713/ajas.15.0711

Copy DOI

Abstract

Guanine nucleotide-binding protein subunit alpha-s (Gnαs) is a small subunit of the G protein-couple signaling pathway, which is involved in the formation of coat color. The expression level and distribution of Gnαs were detected by quantitative real-time-polymerase chain reaction (qPCR), western blot, and immunohistochemistry to investigate the underlying mechanisms of coat color in white and black skin tissues of mice. qPCR and western blot results suggested that Gnαs was expressed at significantly higher levels in black mice compared with that of white mice, and transcripts and protein possessed the same expression in both colors. Immunohistochemistry demonstrated Gnαs staining in the root sheath and dermal papilla in hair follicle of mice skins. The results indicated that the Gnαs gene was expressed in both white and black skin tissues, and the expression level of Gnαs in the two types of color was different. Therefore, Gnαs may be involved in the coat color formation in mice.

Highlights

Coat color is a quality trait of a hereditary basic, and main phenotypic trait, and economic trait, especially for sheep (Fan et al, 2013), rabbit (Jiang et al, 2002), alpaca (Bai et al, 2010; Tian et al, 2015; Yu et al, 2015), and other wool-producing animals
In studying signal transduction of hair follicle, researchers have mainly focused on the melanocortin receptor 1/protein kinase A (MC1R/PKA) signaling pathways (Våge et al, 2014; Dorshorst et al, 2015), Wnt/βcatenin signaling pathways (Enshell-Seijffersa et al, 2010), mitogen-activated protein kinase signaling pathways (Eriksson et al, 2008; Feng et al, 2014), and other signaling pathways, which are involved the growth and development stages of hair follicles and control the proliferation and differentiation of the hair follicle epithelial cells (Tian and Fan, 2006)
Band melanin produced by melanocytes in the hair follicles (Ito intensities were scanned and visualized using Image Lab software with a Bio-Rad system (Bio-Rad, Hercules, CA, USA)

Summary

INTRODUCTION

Coat color is a quality trait of a hereditary basic, and main phenotypic trait, and economic trait, especially for sheep (Fan et al, 2013), rabbit (Jiang et al, 2002), alpaca (Bai et al, 2010; Tian et al, 2015; Yu et al, 2015), and other wool-producing animals. Coat color is dependent on melanin produced by melanocytes at the base of hair follicles. Some subunits of G protein-couple signaling pathway have been found to regulate and control coat color formation by mutation (Van Raamsdonk et al, 2004; 2009). We selected white and black skin of 21 day-old mice and analyzed the Gnαs expression level and distribution in mice skins tissues to explore the relation between Gnαs and pigmentation in G protein-couple signaling pathway. Skin samples were collected and mice were maintained chain reaction (qPCR) was performed using a SYBR in accordance with the International Guiding Principles for Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa, China). Six additional white and black skin tissues (three mice per color) were fixed in 4% paraformaldehyde Western blot analysis of Gnαs and analyzed through immunohistochemistry. RNA integrity was evaluated on the basis of OD260/OD280, sulfate-polyacrylamide gel electrophoresis and transferred which was between 1.8 and 2.0 for the experiment. onto Immobilon-PSQ polyvinylidene difluoride transfer

F: TTGCTGACAGGATGCAGAAG

AND DISCUSSION

CONCLUSION

CONFLICT OF INTEREST