Abstract
To confirm that the cytochrome bc(1) complex exists as a dimer with intertwining Rieske iron-sulfur proteins in solution, four Rhodobacter sphaeroides mutants expressing His-tagged cytochrome bc(1) complexes containing two pairs of cysteine substitutions, one in the interface between the head domain of iron-sulfur protein (ISP) and cytochrome b and the other between the tail domain of ISP and cytochrome b, were generated and characterized. They are: K70C(ISP)/A185C(cytb).P33C(ISP)/G89C(cytb), K70C(ISP)/A185C(cytb).P33C(ISP)/M92C (cytb), K70C (ISP)/A185C(cytb).L34C(ISP)/V64C(cytb), and K70C(ISP)/A185C(cytb).N36C(ISP)/G89C(cytb). The K70C(ISP)/A185C(cytb) cysteine pair cross-links the head domain of ISP and cytochrome b; the P33C(ISP)/G89C(cytb), P33C(ISP)/M92C (cytb), L34C(ISP)/V64C(cytb), and N36C(ISP)/G89C(cytb) cysteine pairs cross-link the tail domain of ISP and cytochrome b. An adduct protein with an apparent molecular mass of 128 kDa containing two cytochrome b and two ISP proteins is detected in the K70C(ISP)/A185C(cytb).P33C(ISP)/G89C(cytb) and K70C(ISP)/A185C(cytb).N36C(ISP)/G89C(cytb) mutant complexes, confirming that the bc(1) complex exists as a dimer with intertwining ISPs. The loss of activity in these two double-cysteine-pair mutant complexes was attributed to the disulfide bond between the head domain of ISP and cytochrome b and not the one between the tail domain of ISP and cytochrome b.
Highlights
Mitochondrial cytochrome bc1 complexes from beef [2, 3], chicken [4], and yeast [5] were crystallized and their three-dimensional structure determined
An adduct protein with an apparent molecular mass of 128 kDa containing two cytochrome b and two iron–sulfur protein (ISP) proteins is detected in the K70C(ISP)/A185C(cytb)1⁄7P33C(ISP)/G89C(cytb) and K70C(ISP)/A185C(cytb)1⁄7N36C(ISP)/G89C(cytb) mutant complexes, confirming that the bc1 complex exists as a dimer with intertwining ISPs
If the complex exists as a dimer, but without intertwining of the two ISPs in the two monomers, or it exists as a monomer, formation of two intersubunit disulfide bonds would yield an adduct protein with an apparent molecular mass of 64 kDa containing only one cytochrome b and one ISP
Summary
Materials—Cytochrome c (horse heart, type III) was purchased from Sigma Chemical Co. N-Dodecyl--D-maltoside and N-octyl--D-glucoside were from Anatrace. For generation of double-cysteine-pair substitutions, the singlestranded pSelectfbcFK70CBA185CCHQ was used as template for mutagenesis, and oligonucleotides used were as follows: K70C(ISP)/A185C (cytb)1⁄7P33C(ISP)/G89C(cytb), GGGGCCGCCGTCTGGTGCCTGATCAACCAAATG/AACGTGAACTGCGGCTTCATGCT; K70C(ISP)/A185C(cytb)1⁄7P33C(ISP)/M92C(cytb), GGGGCCGCCGTCTGGTGCCTGATCAACCAAATG/AACGGCGGCTTCTGCCTGCGCTACCTGCATGC; K70C(ISP)/A185C(cytb)1⁄7L34C(ISP)/V64C(cytb), GCCGTCTGGCCGTGCATCAACCAAATG/GTCACCGGCATCTGCCTTGCGATGCAT; K70C(ISP)/A185C(cytb)1⁄7N36C(ISP)/G89C(cytb), TGGCCGCTGATC-TGCCAAATGAATCCGTC/AACGTGAACTGCGGCTTCATGCT. The presence of engineered mutations was confirmed by DNA sequencing before and after photosynthetic or semi-aerobic growth of the cells as previously reported [17]. The (His)6-tagged cytochrome bc complexes were purified from chromatophores as previously reported [12]. To assay ubiquinol-cytochrome c reductase activity, chromatophores, or purified cytochrome bc complexes were diluted with 50 mM Tris-Cl, pH 8.0, containing 200 mM NaCl and 0.01% N-dodecyl--Dmaltoside to a final concentration of cytochrome b of 5 M. 5 l of the diluted samples was added to 1 ml of assay mixture containing 100 mM Naϩ/Kϩ phosphate buffer, pH 7.4, 300 M EDTA, 100 M cytochrome c, and 25 M Q2H2.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
