Evaluation of the promoter region polymorphism (5-HTTLPR) in the serotonin transporter gene in females with postpartum depression.

Xiaoli Zhang,Yuanzhen Zhang,Lin Wang,Jiafu Li,Han Xue,Li Xiong,Fenghua Huang

doi:10.3892/etm.2014.2043

Abstract

The aim of the present study was to investigate the association between polymorphism in the serotonin transporter (5-HTT) gene-linked polymorphic region (5-HTTLPR) in the promoter region of the 5-HTT gene and the pathogenesis of postpartum depression (PPD). Blood samples were collected from 120 female patients with PPD and 140 age-matched normal controls. Polymerase chain reaction analysis was performed to detect the 5-HTTLPR polymorphism in these subjects, and the genotype and allele frequencies were compared between the two groups. The disease severity was evaluated using the Hamilton Depression Rating Scale (HAMD) score. The results showed that the frequency of the homozygous long/long (L/L) genotype was significantly lower in the PPD group than that in the control group; by contrast, the frequencies of the heterozygous long/short (L/S) and homozygous S/S genotypes were similar for the two groups, without significant differences. No significant differences were observed in the L and S allele frequencies between the two groups. Furthermore, compared with the L/S heterozygous and S/S homozygous genotypes, patients with PPD with the L/L homozygous genotype had a significantly lower HAMD score. The present results suggest that female patients with PPD carrying the homozygous L/L genotype may be less susceptible to depressive symptoms and that the L/L genotype may be associated with the reduced occurrence of PPD. These findings provide a theoretical basis for the clinical diagnosis and treatment of PPD.

Highlights

Postpartum depression (PPD) is a mood disorder in females that usually presents within the first 4‐6 weeks after childbirth; the condition is clinically characterized by depression, sadness, frustration, crying, irritability, restlessness and even suicidal tendencies [1]
A recent study indicated that the transcriptional activity of the human 5‐HTT gene is regulated by the 5‐HTT gene‐linked polymorphic region (5‐HTTLPR) [11], with long (L) and short (S) alleles
Amplification primers for the promoter region of the 5‐HTT gene were as follows: Forward primer, 5'‐GCGCTCCTGCATCCCCCATTA‐3'; and reverse primer, 5'‐ GGGATGCGGGGGA ATACTGGT‐3'. 5‐H T TL PR polymorphism in the 5‐HTT promoter region was assessed using polymerase chain reaction (PCR) amplification

Summary

Introduction

Postpartum depression (PPD) is a mood disorder in females that usually presents within the first 4‐6 weeks after childbirth; the condition is clinically characterized by depression, sadness, frustration, crying, irritability, restlessness and even suicidal tendencies [1]. In addition to the general symptoms of depression, PPD can, in certain cases, be associated with a disturbance of consciousness, psychotic symptoms and Schneider's symptoms, which can only be alleviated by regular treatments [3,4]. Recent genetic studies have shown that dysfunction of the 5‐hydroxytryptamine (5‐HT) system is the key factor in the development of depression [7,8]. Genes associated with the synthesis, release, uptake and metabolism of 5‐HT could become candidates for studies on the pathogenesis of depression. A recent study indicated that the transcriptional activity of the human 5‐HTT gene is regulated by the 5‐HTT gene‐linked polymorphic region (5‐HTTLPR) [11], with long (L) and short (S) alleles. The L allele in 5‐HTTLPR is associated with higher transcriptional efficiency of the promoter compared with the S allele. The mRNA transcription and protein expression levels of 5‐HTT are higher in individuals with a homozygous L/L genotype than those with S/S genotypes [12]

Objectives

Methods

Results