Abstract

Background Neonatal sepsis diagnosis is a challenge because of its nonspecific presentation together with low sensitivity of the time-consuming bacterial cultures. So, many sepsis markers, like C-reactive protein (CRP), procalcitonin (PCT), and interleukin-6 (IL-6), are emerging to improve its diagnosis. Aim This study was done to investigate the role of CRP, PCT, and IL-6 in promoting the early diagnosis of neonatal sepsis in an attempt to decrease morbidity and mortality. Methods This cross-sectional study was conducted on 50 neonates suspected with sepsis enrolled from the neonatal intensive care unit (NICU) of Zagazig University Hospitals, Egypt. Blood cultures for these neonates were done before starting antibiotics. Also, bacterial DNA was revealed from the blood by broad-range 16S rDNA polymerase chain reaction (PCR). Measurements of CRP using the immunoturbidimetry method, PCT using fluorescence immunoassay quantitative method, and IL-6 using commercially available ELISA kit were done to all enrolled neonates. Results Forty-one neonates with proved sepsis were found to be positive in blood culture and/or PCR for bacterial 16S rDNA. The most common isolated organisms were Klebsiella (61.3%), followed by E. coli (9.7%) and CONS (9.7%). We detected much significant higher levels of PCT, CRP, and IL-6 in the proved sepsis group than the suspected neonatal sepsis cases (p ≤ 0.001, 0.001, and 0.004, respectively). Serum PCT levels showed the highest sensitivity, specificity, PPV, NPV, and accuracy of 97.6%, 89%, 97%, 88.9%, and 96% than other studied sepsis markers. Conclusion PCT has satisfactory characteristics as a good marker than IL-6 and CRP for the diagnosis of neonatal sepsis.

Highlights

  • BackgroundNeonatal sepsis diagnosis is a challenge because of its nonspecific presentation together with low sensitivity of the time-consuming bacterial cultures

  • Neonatal sepsis is a generalized bacterial infection of the neonate’s blood during the first month of life

  • ® DNA was extracted from the blood by QIAamp DNA Mini kit (Qiagen GmbH, Hilden, Germany) according to manufacture instructions, subjected to broad-range bacterial 16S rDNA polymerase chain reaction (PCR). e primers used were supplied from ermoFisher Scientific, USA, and their sequences are listed in Table 1. ese primers react with highly conserved regions of the bacterial 16S rRNA gene to provide PCR products of about 500 base pairs. e PCR reaction was performed in a total reaction mixture of 50 μl, containing 25 μl of Taq PCR Master Mix (Qiagen GmbH, Hilden, Germany), 2 μl of each primer, 11 of μl RNase free water, and 10 μl of template DNA [5]

Read more

Summary

Background

Neonatal sepsis diagnosis is a challenge because of its nonspecific presentation together with low sensitivity of the time-consuming bacterial cultures. Aim. is study was done to investigate the role of CRP, PCT, and IL-6 in promoting the early diagnosis of neonatal sepsis in an attempt to decrease morbidity and mortality. Is cross-sectional study was conducted on 50 neonates suspected with sepsis enrolled from the neonatal intensive care unit (NICU) of Zagazig University Hospitals, Egypt. Blood cultures for these neonates were done before starting antibiotics. Forty-one neonates with proved sepsis were found to be positive in blood culture and/or PCR for bacterial 16S rDNA. PCT has satisfactory characteristics as a good marker than IL-6 and CRP for the diagnosis of neonatal sepsis

Introduction
Materials and Methods
F: TGAAGAGTTTGATCATGGCTCAG R
Discussion
Albicans
Conclusion

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.