Abstract
EvaGreen® Real-Time PCR method has been used for celery(Apium graveolens) allergen detection. A primer designed in mannitol dehydrogenase gene region has been used for specific celery identification in sample. The results show possibility to create calibration curve using artificially adulterated samples. The increasing variability between parallel calibration of celery samples has been observed from 0.1 % to 100%. Detection limit has been set to value 0.1% in celery representing 1000 ppm. Fluorescent signal has been presented even in samples with lower percentage addition of celery but these samples have been excluded according to unspecific
Highlights
EvaGreen® Real-Time PCR method has been used for celery(Apium graveolens) allergen detection
Získané dáta boli spracované do tabuliek v programe EXCEL 2007
SYBR Green Real-Time PCR used to detect celery in food
Summary
Príprava vzoriek Príprava vzorky zo zakúpenej hľuzy zeleru spočívala v umytí hľuzy, ošúpaní, nastrúhaní jadra hľuzy a následným sušením pri teplote 60 ° C 12 hodín. Zelerový prášok s múkou sme miešali desiatkovým systémom riedenia nasledovne: 0,5g vzorky zeleru na 4,5g hladkej múky. Takýmto spôsobom sme pripravili 9 riedení od 100% kontrolnej vzorky (vzorka čistého zelerového prášku) aţ po vzorku s obsahom zeleru 0,000001%. Na detekciu prítomnosti zeleru vo vzorke sme pouţili primery na detekciu manitol dehydrogenázy (GenBank, Accession No AF067082). Primery sme pouţili od autorov (Dovičovičová et al, 2004). Autori navrhli primery celF 5 ́CAGCCTGTTTCCCGTACGAGAT -3 ́ a celR 5 ́ TGCCAAATAAAGATTCGAGATTGT -3 ́. Primery boli otestované s nehomologickými DNA sekvenciami iných rastlín pouţitím softvéru Blast 2.1 ročník 5 potravinárstvo (National Center for Biotechnology Information, Bethesda,Md., USA),(Jurčáková et al, 2011). PCR reakcia: EvaGreen Real-Time PCR Reakčná zmes na jednu vzorku pre PCR v celkovom objeme 20μl bola pripravená z 10μl Fast EvaGreen® qPCR Master Mix (Biotium), 6μl bidestilovanej vody, 2μl templátovej DNA a primermi celF a celR po 1μl, tak, ako to stanovuje výrobca v uţívateľskom manuáli
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
