Emergence of high-level azithromycin resistance in Campylobacter jejuni isolates from pediatric diarrhea patients in Kolkata, India.

Abstract

Campylobacterspeciesinfectionistheleadingcauseofbacterialenteritis worldwide. MostCampylobacterinfections cause acute, selflimiting diarrheal disease. However, patients with more severe disease and immunologically compromised patients need antibiotic treatment (1). The most common antimicrobial agents used inthetreatmentofCampylobacterinfectionsarefluoroquinolones and macrolides. In India, fluoroquinolone resistance has increased markedly (more than 85%) in recent years (2, 3). Resistance toward macrolides varies from place to place. In northern India, the macrolide resistance was 6.1% during 2005 (4) and reached 22.2% in 2013 (2). From 2008 to 2010, macrolide resistance was only 0.7% in eastern India (3). Onehundredsixty-sixCampylobacterjejunistrainsisolatedfrom pediatric diarrhea cases (children of 5 years) at B. C. Roy Children’s Hospital, Kolkata, India, from 2010 to 2012 were tested for macrolide resistance. About 4% of the isolates (6/166) were macrolide resistant by the disc diffusion method. The Etest (Biomeriux) assay with azithromycin indicated that five isolates were resistant to concentrations up to 256 g/ml. When tested by the dilutionmethod(5),twoisolateswereresistanttoazithromycinat 1,000 g/ml and three others had azithromycin MICs between 500 and 1,000 g/ml. Macrolide resistance in Campylobacter is associated mainly with a point mutation(s) occurring within the peptidyltransferaseregionindomainVofthe23SrRNAgene,the target of macrolides. Sequencing analysis of a 552-bp amplicon of the V region of the 23S rRNA gene using primers F2-Campy-23S (AATTGATGGGGTTAGCATTAGC)(6)and2420R-Campy-23S (AGAACCACCGGATCACTAAGA) revealed the presence of an