Abstract

Infectious and parasitic diseases have major negative economic and animal welfare impacts on aquaculture of salmonid species. Improved knowledge of the functional basis of host response and genetic resistance to these diseases is key to developing preventative and treatment options. Cell lines provide valuable models to study infectious diseases in salmonids, and genome editing using CRISPR/Cas systems provides an exciting avenue to evaluate the function of specific genes in those systems. While CRISPR/Cas editing has been successfully performed in a Chinook salmon cell line (CHSE-214), there are no reports to date of editing of cell lines derived from the most commercially relevant salmonid species Atlantic salmon and rainbow trout, which are difficult to transduce and therefore edit using lentivirus-mediated methods. In the current study, a method of genome editing of salmonid cell lines using ribonucleoprotein (RNP) complexes was optimised and tested in the most commonly used salmonid fish cell lines: Atlantic salmon (SHK-1 and ASK cell lines), rainbow trout (RTG-2) and Chinook salmon (CHSE-214). Electroporation of RNP based on either Cas9 or Cas12a was efficient at targeted editing of all the tested lines (typically > 90% cells edited), and the choice of enzyme expands the number of potential target sites for editing within the genomes of these species. These optimised protocols will facilitate functional genetic studies in salmonid cell lines, which are widely used as model systems for infectious diseases in aquaculture.

Highlights

  • Salmonid fish are amongst the highest value aquaculture species globally, together worth in excess of $22Bn in 2017 (FAO 2019)

  • Genome editing of salmonid cell lines remains in its infancy, with the first report of successful CRISPR/Cas editing being in the Chinook salmon (Oncorhynchus tshawytscha) cell line (CHSE-EC, derived from CHSE-214), which was engineered to stably express Cas9 and EGFP (Dehler et al 2016)

  • The cell lines used in this study were as follows: (i) salmon head kidney 1 (SHK-1), an immortalised cell line from Atlantic salmon (Salmo salar) obtained from the European Collection of Authenticated Cell Cultures (ECACC) (97111106); (ii) Atlantic salmon kidney (ASK), an immortalised cell line from Atlantic salmon (S. salar) obtained from American Type Culture Collection (ATCC; CRL2747); (iii) rainbow trout gonad (RTG-2), an immortalised cell line from rainbow trout (O. mykiss) obtained from ECACC (90102529); and (iv) Chinook salmon embryo 214 (CHSE214), an immortalised cell line from Chinook salmon (O. tshawytscha) obtained from ECACC (91041114)

Read more

Summary

Introduction

Salmonid fish are amongst the highest value aquaculture species globally, together worth in excess of $22Bn in 2017 (FAO 2019). Genome editing of salmonid cell lines remains in its infancy, with the first report of successful CRISPR/Cas editing being in the Chinook salmon (Oncorhynchus tshawytscha) cell line (CHSE-EC, derived from CHSE-214), which was engineered to stably express Cas and EGFP (Dehler et al 2016) This line has subsequently been applied to develop a clonal STAT2 knockout line to study the role of this gene in viral response (Dehler et al 2019), and as a proof-of-principle to demonstrate that transduction of lentivirus facilitates high-efficiency editing (Gratacap et al 2020). The efficiency of Cas or Cas12a editing using RNP in salmonid cell lines is unknown, and these approaches may help overcome the aforementioned challenges to cell line editing in cell lines of Atlantic salmon and rainbow trout, two of the world’s most important aquaculture species. Electroporation of Cas12a RNP which uses a different protospacer adjacent motif (PAM) of 5’TTTV led to high genome editing ( less than Cas9), expanding the number of potential target editing sites in these species’ genomes

Materials and Methods
F1: CAATCACAGGTGGGAAAAGGGC
Results
Discussion
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call