Abstract
Dioscorea rotundata is an economically important food crop in many tropical countries as many people in this region depend on it for food and livelihood. Viral diseases, especially Yam mosaic virus (YMV), constitute a major constraint in the cultivation of this crop as they perpetuate through generations in the vegetatively propagated planting materials. Getting resistant or at least virus-free planting materials for farmers thus becomes crucial. This study was aimed at eliminating YMV in Dioscorea rotundata by cryotherapy of axillary buds. Enlarged axillary buds of YMV-infected TDr 2269 were frozen in liquid nitrogen for 1 h, re-warmed at 40 °C and cultured to regenerate plantlets. Approximately 76.33% plantlet regeneration and 100% YMV eradication were obtained for cryo-treated buds, against 95% and 0% obtained respectively for non-treated buds. RT-PCR and RT-qPCR analyses did not reveal detectable quantity of YMV in treated plants but did in control plants. Plants from cryo-treated buds showed no mosaic symptoms and produced slightly more tubers, and heavier mini-tubers (20.48±3.11 g) under greenhouse conditions contrary to non-treated plants that showed severe mosaic symptoms with significantly smaller tubers (1.91±0.39 g) (P < 0.05). This is the first report showing the elimination of YMV from infected white yam stock plant by cryotherapy and would be useful for producing clean planting materials.
Highlights
The world’s human population currently estimated at 7.7 billion is expected to exceed 9 billion by 2050 (Braun, 2010; UN, 2017)
One micro liters of the cDNA was used for PCR to detect 161 bp of Yam mosaic virus (YMV)-CP gene using the primers: YMV-CP5P: GTGGACAATGATGGACGGTG and YMV-CP3P: CGTATCGGGGCATA
The established YMV-free plants (10 lines, 6 plants per line) and the control (6 plants) in the greenhouse were assessed every day for mosaic symptoms development but the final classification was recorded 17 weeks after transfer to the soil
Summary
The world’s human population currently estimated at 7.7 billion is expected to exceed 9 billion by 2050 (Braun, 2010; UN, 2017) This will be driven by India and African countries, and Nigeria is expected to be the third largest with 411 million human population after China (1.3 billion) and India (1.6 billion) according to forecast by the 2017 revision of world population reports (UN, 2017). Such a rapidly increasing population will pose a great challenge for global food security. Ita et al / South African Journal of Botany 130 (2020) 123À129
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
