Abstract

In this paper, we propose a new layout algorithm that draws the secondary structure of a Ribonucleic Acid (RNA) automatically according to some of the biologists’ aesthetic criteria. Such layout insures that two equivalent structures (or sub-structures) are drawn in a same and planar way. In order to allow a visual comparison of two RNAs, we use an heuristic that places the biggest similar part of the two structures in the same position and orientation.

Highlights

  • Ribonucleic Acid (RNA) is an important molecule, which performs a wide range of functions in biological systems

  • Some RNA is found in the nucleus, and in the cytoplasm, as messenger RNA or mRNA, transfer RNA or tRNA, ribosomal RNA or rRNA

  • In order to present the biologist face to two RNAs with the same orientation on the screen, we use an heuristic based on quasi-isomorphic subtrees in a tree

Read more

Summary

Introduction

Ribonucleic Acid (RNA) is an important molecule, which performs a wide range of functions in biological systems. One important requirement to facilitate visual comparison of structures is to automatically detect parts of the structure that have the same shape and to place them at the same position and in the same orientation in the final drawing. This is useful for the user because it will give him reference marks when he will compare the structures. In order to present the biologist face to two RNAs with the same orientation on the screen, we use an heuristic based on quasi-isomorphic subtrees in a tree. We conclude with future work to be done in order to match the requirements of biologists

RNA background
A A C GCCGGGCUGCUCGGAACGAACGAUGGUGGCCCAGUUGACAA
Drawing RNA secondary structure
Outer-planarization
Tree drawing
Final drawing
RNAs pairwise Placement
Conclusion
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call