Effect of site-directed mutagenesis at the GGEEF domain of the biofilm forming GGEEF protein from Vibrio cholerae.

Om Prakash Chouhan,Sumit Biswas,Mousumi Hazra,Ashish Baghudana,Saugata Hazra,Divya Bandekar

doi:10.1186/s13568-015-0168-6

Abstract

Vibrio cholerae, the cause of seven noted pandemics, leads a dual lifecycle—one in the human host in its virulent form, and the other as a sessile, non-virulent bacterium in aquatic bodies in surface biofilms. Surface biofilms have been attributed to be associated with a ubiquitous protein domain present in all branches of bacteria, known as the GGD(/E)EF domain. While the diguanlyate cyclase activities of these proteins are universally established, the role of these proteins as diguanlyate-specific phosphodiesterases in conjunction with a EAL domain has also been reported. The VC0395_0300 protein from V. cholerae which shows biofilm forming abilities also acts as a phosphodiesterase. Interestingly, this GGD(/E)EF protein contains a EAL site in the reverse orientation. We attempted to mutate the GGEEF signature along the sequence by site-directed mutagenesis. The resultant mutants (Sebox5–7) did not show much difference in phosphodiesterase activity in comparison with the wild type protein (Sebox3), indicating the independence of the phosphodiesterase activity of the protein from the GGD(/E)EF domain. However, the ability of the mutants to form surface biofilm was significantly lesser in the case of mutations in the three central positions of the signature domain.

Highlights

The Gram negative flagellate V. cholerae survives as a non-motile, non-virulent, biofilm in aquatic bodies in between cholera epidemics
The gene encoding VC0395_0300 from V. cholerae was PCR amplified with DreamTaq DNA polymerase (Fermentas) and the following primers: Sebox 1A (BamHI, XhoI) 5′AATACTGGATCCATGAAAAATTG GCTGTG TCAGGCAGTG 3′ and 5′AATACT CTCG AGTTATTCTGTGGATTGGCGATAGATACA 3′
Growth of the mutants in LB medium and transfer to static conditions for observation of biofilm formation was undertaken for separate sets at 2, 4 and 7 days intervals. After both 4 and 7 days, it was observed that the biofilm formation was significantly lower for the mutant Sebox5, 6 and 7 cultures when compared to the Sebox3 wild type

Summary

Introduction

The Gram negative flagellate V. cholerae survives as a non-motile, non-virulent, biofilm in aquatic bodies in between cholera epidemics. Mutation in the ‘GEE’ positions affects biofilm formation in V. cholerae Site directed mutagenesis at the positions G, E and E of the GGEEF sequence in VC0395_0300 resulted in the generation of mutants with altered amino acids. After both 4 and 7 days, it was observed that the biofilm formation was significantly lower for the mutant Sebox5, 6 and 7 cultures when compared to the Sebox3 wild type.

Results

Conclusion