Abstract
Background Lipids are one of the major pollutants in domestic and industrial effluents. The use of lipases in the treatment of these effluents as well as in the bioremediation of contaminated environments represents an environmentally safe alternative to chemical methods [1]. Lipases (EC 3.1.1.3) are carboxylesterases that catalyze synthesis and hydrolysis of long-chain acylglycerols (>10 carbons) and have great potential for industrial and biotechnological applications. Microorganisms are the major source for lipases and have advantages such as ease production and diversified enzymatic properties [2]. Effluents containing high concentrations of lipids represent a good source for the isolation of lipase producing microorganisms and dairy industries are responsible for production of large quantities of this of this kind of effluent [3]. In a previous study two lipase producing microorganisms were isolated from dairy effluents. This report presents the results of lipase production by these microorganisms in different carbon sources.
Highlights
Lipids are one of the major pollutants in domestic and industrial effluents
The 16S rDNA was amplified from chromosomal DNA using primers fD1 (AGAGTTTGATCCTGGCTCAG) and rD1 (AAGGAGGTGATCCAGCC) for Escherichia coli K-12 [4]
The 16S rRNA gene sequences obtained were compared with sequences of other Aeromonas deposited in the GenBank database by using ClustalW program and a consensus neighbor-joining tree was constructed using Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0 [5]
Summary
Lipids are one of the major pollutants in domestic and industrial effluents. The use of lipases in the treatment of these effluents as well as in the bioremediation of contaminated environments represents an environmentally safe alternative to chemical methods [1]. Methods Isolates LODO 9 and LODO 10 were cultured overnight in DYG’S media (28°C, 200 rpm) and genomic DNA was extracted using AxyPrepTM Bacterial Genomic DNA Miniprep Kit (Axygen Biosciences) according to manufacturer recommendation. The 16S rDNA was amplified from chromosomal DNA using primers fD1 (AGAGTTTGATCCTGGCTCAG) and rD1 (AAGGAGGTGATCCAGCC) for Escherichia coli K-12 [4]. The 16S rRNA gene sequences obtained were compared with sequences of other Aeromonas deposited in the GenBank database by using ClustalW program and a consensus neighbor-joining tree was constructed using Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0 [5].
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
