Effect of β‐carotene and retinoic acid on PPARγ expression during bovine white adipose tissue differentiation in vitro.

Abstract

White adipose tissue is the main source of mammalian metabolic energy. Adipocytes are important in animal production as the presence of fat is correlated to carcass quality. PPARγ is a transcription factor expressed in the final process of adipose differentiation. Our objective was to study the effect of β‐carotene and 9‐cis‐retinoic acid on the expression of PPARγ during bovine adipocyte differentiation. Samples were collected at slaughter from subcutaneous adipose tissue and processed in a solution containing 1 mg/mL Type II collagenase for 2 h at 37°C. Cells were re‐suspended with a basal medium, DMEM containing 5% fetal bovine serum, seeded in 24‐well culture plates at a density of 1×104 cells/cm2 and incubated at 37°C under a humidified 5% CO2 atmosphere. Before reaching confluence, preadipocyte differentiation was induced by treatments: basal; differentiation medium (2.5 μg/mL insulin); rosiglitazone (20 μM); β‐carotene (10, 20, 30 μM); 9‐cis‐retinoic acid (0.5, 0.75, 1 μM). PPARγ expression was identified purifying RNA from differentiated cells and using the RT‐PCR. Total RNA was extracted from the cells by QIAGEN™ protocol (RNeasy Kit). RT was made using oligo (dT)12–18 primer; Real Time PCR with PPARγprimers: Forward 5′‐CATCTTCCAGGGGTGTCAGT; Reverse 5′‐GGATATGAGGACCCATCCT. The results show that β‐carotene does not stimulate the process (P>0.1), however 9‐cis‐retinoic acid does (P<0.05).