Abstract
The family of UDP-GalNAc:polypeptide alpha-N-acetylgalactosaminyltransferases (ppGalNAcTs) is unique among glycosyltransferases, containing both catalytic and lectin domains that we have previously shown to be closely associated. Here we describe the x-ray crystal structures of human ppGalNAcT-2 (hT2) bound to the product UDP at 2.75 A resolution and to UDP and an acceptor peptide substrate EA2 (PTTDSTTPAPTTK) at 1.64 A resolution. The conformations of both UDP and residues Arg362-Ser372 vary greatly between the two structures. In the hT2-UDP-EA2 complex, residues Arg362-Ser373 comprise a loop that forms a lid over UDP, sealing it in the active site, whereas in the hT2-UDP complex this loop is folded back, exposing UDP to bulk solvent. EA2 binds in a shallow groove with threonine 7 positioned consistent with in vitro data showing it to be the preferred site of glycosylation. The relative orientations of the hT2 catalytic and lectin domains differ dramatically from that of murine ppGalNAcT-1 and also vary considerably between the two hT2 complexes. Indeed, in the hT2-UDP-EA2 complex essentially no contact is made between the catalytic and lectin domains except for the peptide bridge between them. Thus, the hT2 structures reveal an unexpected flexibility between the catalytic and lectin domains and suggest a new mechanism used by hT2 to capture glycosylated substrates. Kinetic analysis of hT2 lacking the lectin domain confirmed the importance of this domain in acting on glycopeptide but not peptide substrates. The structure of the hT2-UDP-EA2 complex also resolves long standing questions regarding ppGalNAcT acceptor substrate specificity.
Highlights
The first committed step of carbohydrate addition to mucin-type glycoproteins is catalyzed by a family of UDP-GalNAc:polypeptide ␣-Nacetylgalactosaminyltransferases,2 yielding the Tn antigen (GalNac-␣-1-O-Ser/Thr)
The primary structure of ppGalNAcTs is similar to other type II Golgi membrane glycosyltransferases, but the ppGalNAcTs are unique among glycosyltransferases in possessing a C-terminal, ricin-type lectin domain of Ϸ130 residues containing three putative carbohydrate-binding sites (13)
The properties of ppGalNAcT acceptor substrates have been studied for nearly 15 years through data base analyses of known O-glycosylation sites (33, 34), in vitro studies using defined peptide acceptors (31, 35), sequencing of tissue-extracted mucins (36, 37), and more recently systematic variation of the amino acids flanking acceptor threonine residues (38)
Summary
The annealed primers 5Ј-AATTCGATGCGCATCATCATCATCATCATGAAAACTTGTACTTTCAATCTGA and 5Ј-CGCGTCAGATTGAAAGTACAAGTTTTCATGATGATGATGATGATGCGCATC encoding 6 histidine residues followed by a tobacco etch virus (TEV) protease cleavage site were cloned into the EcoRI/MluI sites of the plasmid pKN55 (16) to create the plasmid pKN55-N6His-TEV. The catalytic domain of hT2 (residues 75– 440) was PCR-amplified using the primers 5Ј-ACCACGGCTTGAAAGTACGGTGGCCAGACTTT and 5Ј-ACCACCGGTCTATGGAACCCTTAACTCTGGATAGAC and cloned between the MluI/AgeI sites of pKN55-N6His-TEV. Ternary complex (hT2-UDP-EA2-Mn2ϩ) crystal growth was initiated by mixing 0.5–1 l of protein solution containing 5.8 mg/ml hT2, 2 mM Tris (pH 8.0), 0.5 mM EDTA, 10 mM -ME, 10 mM UDP, 10 mM MnCl2, and 5 mM EA2 with an equal volume of precipitant solution containing 23–25% polyethylene glycol 1000, 100 mM Hepes (pH 7.0). Binary complex (hT2-UDP-Mn2ϩ) crystal growth was initiated by mixing 0.5–1 l of protein solution containing 5.8 mg/ml hT2, 2 mM Tris (pH 8.0), 0.5 mM EDTA, 10 mM -ME, 10 mM UDP, 10 mM MnCl2, and 5 mM EA2 with an equal volume of precipitant solution containing 7–10% polyethylene glycol 6000, 100 mM Hepes (pH 7.0). Resolution (Å) Unique reflections Completeness (%) Rmerge (%)b Molecules/asymmetric unit
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
