Abstract

One of the areas of biotechnology sunflower is the development and testing of DNA markers of important agronomic traits and in particular markers of resis tance to downy mildew. Resistance of 16 Rf-lines of sunflower to the races 330 and 710 of Plasmopara halstedii has been studied. Genotyping of these lines was carried out using 9 STS-markers of three Pl -loci, Pl 5, Pl 6 and Pl 8, associated with the resistance of sunflower to downy mildew. Only two out of nine STS-markers, НаР 2 and НаР 3 (locus Pl 6), allowed us to identify the lines, which demonstrated resistance to the downy mildew under the conditions of artificial infection.

Highlights

  • Downy mildew of sunflower is induced by the fungus Plasmopara halstedii (Farl.) Berl and de Toni

  • The present study was aimed at the assessment of selected samples of sunflower to the downy mildew races 330 and 710 under laboratory conditions and genotyping of sunflower lines characterized by different level of resistance process, which deals with the creation of infectious to downy mildew using STS-markers of three Pl-loci

  • Our experiments revealed the sunflower lines, which were characterized by different sensitivity to the downy mildew

Read more

Summary

INTRODUCTION

Downy mildew of sunflower is induced by the fungus Plasmopara halstedii (Farl.) Berl and de Toni. Breeding of sunflower aimed at the resistance to downy mildew is considered to be one of the most priority tasks. In the South of Russia, including Rostov region, the selection of sunflower with respect to the resistance to downy mildew should be carried out mainly on the basis of races 330, 710 and 730. The present study was aimed at the assessment of selected samples of sunflower to the downy mildew races 330 and 710 under laboratory conditions and genotyping of sunflower lines characterized by different level of resistance process, which deals with the creation of infectious to downy mildew using STS-markers of three Pl-loci.

MATERIALS AND METHODS
F: TAGTTAACCATGGCTGAAACCGCTG
RESULTS AND DISCUSSION
CONCLUSION
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call