Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Carmen Festa,Angela Zampella,Daniela Benigno,Antonella Virgilio,Aldo Galeone,Veronica Esposito,Simona De Marino

doi:10.3390/ijms23031092

Carmen Festa, Angela Zampella + Show 5 more

Open Access

https://doi.org/10.3390/ijms23031092

Copy DOI

Abstract

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (ABr), 8-oxo-2′-deoxyadenosine (Aoxo) or β-L-2′-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Highlights

DNA-based asymmetric catalysis has recently attracted increasing attention, becoming a interesting tool for organic chemical synthesis
In order to propose the design of new G-quadruplex DNA structures (G4 DNA) enantioselective catalysts for sulfoxidation reaction, by using commercially available adenosine derivatives, a series of HT21 analogues were prepared and their catalytic properties were evaluated
The site-specific replacement of loop adenosines with 8-bromo20 -deoxyadenosine or 8-oxo-20 -deoxyadenosine did not affect appreciably the catalytic activity, it drastically has reduced the chiral selectivity, probably suggesting that the modification at C-8 position of adenosine negatively interfered with the microenvironment surrounding the substrate, which is essential to ensure the product chiral induction

Summary

Introduction

DNA-based asymmetric catalysis has recently attracted increasing attention, becoming a interesting tool for organic chemical synthesis. The right-handed chiral conformation of dsDNA plays a key role in enantioselective catalysis, making this secondary structure a promising chiral inducer [1,2,3,4]. A DNA-based catalyst comprises a non-chiral ligand that can chelate a transition metal ion; the catalyzed reaction takes place in, or very close to, the DNA helix to allow the chirality of DNA to be transferred onto the reaction [1,2,3,4]. The DNA double helix provides the chiral microenvironment to selectively form one enantiomer of a given reaction product. Taking advantage of the unique structure of L-DNA, left-helical enantioselective induction has been obtained in different DNA-based asymmetric catalyzed reactions, allowing tuning the absolute configuration in DNA-based asymmetric catalysis, predicting access to both enantiomers for any reaction [6]

Methods

Results

Conclusion