Direct role of FLT3 in regulation of early lymphoid progenitors.

Alya Zriwil,Trine A Kristiansen,Ewa Sitnicka,Lilian Wittmann,Claus Nerlov,Charlotta Böiers,Sten E W Jacobsen,Joan Yuan

doi:10.1111/bjh.15578

Abstract

SummaryGiven that FLT3 expression is highly restricted on lymphoid progenitors, it is possible that the established role of FLT3 in the regulation of B and T lymphopoiesis reflects its high expression and role in regulation of lymphoid‐primed multipotent progenitors (LMPPs) or common lymphoid progenitors (CLPs). We generated a Flt3 conditional knock‐out (Flt3 fl/fl) mouse model to address the direct role of FLT3 in regulation of lymphoid‐restricted progenitors, subsequent to turning on Rag1 expression, as well as potentially ontogeny‐specific roles in B and T lymphopoiesis. Our studies establish a prominent and direct role of FLT3, independently of the established role of FLT3 in regulation of LMPPs and CLPs, in regulation of fetal as well as adult early B cell progenitors, and the early thymic progenitors (ETPs) in adult mice but not in the fetus. Our findings highlight the potential benefit of targeting poor prognosis acute B‐cell progenitor leukaemia and ETP leukaemia with recurrent FLT3 mutations using clinical FLT3 inhibitors.

Highlights

Haematopoiesis is characterized by a very high turnover of mature blood cells of multiple lineages as well as their progenitors, a process partly regulated by a large number of haematopoietic growth factors or cytokines (Metcalf, 2008)
Whereas bone marrow cellularity was not affected (Figure S1A), adult Vav1cre/+Flt3fl/fl mice demonstrated a complete loss of FLT3 expression on LinÀSCA-1+KIT+ (LSK) cells as well as LinÀSCA-1lowKITlowIL7R+ common lymphoid progenitors (CLPs) (Figure S1B)
In agreement with previous studies of conventional germ-line Flt3 and Flt3l knockout mice (Mackarehtschian et al, 1995; McKenna et al, 2000; Sitnicka et al, 2003, 2007), pan-haematopoietic loss of FLT3 expression from early fetal development did not affect numbers of LSKCD48ÀCD150+ long-term (LT)-haematopoietic stem cells (HSCs) (Figure S1C)

Summary

Methods

The Flt floxed/floxed conditional knock-out (Flt3fl/fl) mouse line was generated using a DNA targeting construct in which the genomic fragment of the mouse Flt gene has exon 15 flanked by LoxP sites (flox) and with an Frt-neomycin-Frt cassette inserted into intron 15 of the mouse Flt gene. The IB10/C embryonic stem (ES) cell line (E14 subclone 129/Ola) was electroporated with the targeting construct and targeted clones selected using neomycin. Correctly-targeted ES clones were introduced into C57BL6 blastocysts by injection into the blastocyst cavity. Offspring positive for the floxed Flt allele were crossed with Flp-deleter mice to remove the neomycin cassette. Screening of Flt3fl/fl mice was carried out using 2 primers flanking the 50 loxP site Primer 1: AGATGCCAGGACATCAGGAACCTG and Primer 2: ATCAGCCACACCAGACACAGAGATC. Flt3fl/fl mice were backcrossed for more than 5 generations with C57/Bl6 mice and subsequently crossed with different Cre-recombinase mouse strains (all on a C57/Bl6 genetic background)

Results

Discussion

Conclusion