Differences in serological IgA responses to recombinant baculovirus-derived human papillomavirus E2 protein in the natural history of cervical neoplasia.

L Rocha-Zavaleta,F Clarke,Nj Maitland,S Pepper,Sn Stacey,Cm Sanders,D Jordan,G Corbitt,Pl Stern,Jr Arrand

doi:10.1038/bjc.1997.197

Abstract

Infection with certain types of human papillomavirus (HPV) presents a high risk for the subsequent development of cervical intraepithelial neoplasia (CIN) and cervical carcinoma. Immunological mechanisms are likely to play a role in control of cervical HPV lesions. The HPV E2 protein has roles in virus replication and transcription, and loss of E2 functions may be associated with progression of cervical neoplasia. Accordingly, it is of interest to monitor immune responses to the E2 protein, and previous studies have reported associations between serological reactivity to E2 peptide antigens and cervical neoplasia. In order to investigate serological responses to native, full-length E2 protein, we expressed HPV-16 E2 proteins with and without an N-terminal polyhistidine tag using the baculovirus system. Purified HPV-16 E2 protein was used to develop enzyme-linked immunosorbent assays to detect serological IgG and IgA responses in cervical neoplasia patients and controls. We found that serum IgA levels against the E2 protein were elevated in CIN patients relative to normal control subjects but were not elevated in cervical cancer patients. Moreover, there appeared to be a gradient of response within cervical neoplasia such that the highest antibody levels were seen in lower grades of neoplasia up to CIN 2, whereas lower levels were observed in CIN 3 and still lower levels in cervical carcinoma. These findings suggest that the IgA antibody response to E2 may associate with stage and progression in cervical neoplasia.

Highlights

We report here on the expression, characterization and purification of HPV16 E2 using baculovirus, the development of serological ELISAs and the finding that the IgA response to E2 varies dramatically with different stages of cervical neoplasia
The E2 open reading frame was amplified by polymerase chain reaction (PCR) and recombinant baculoviruses generated using standard techniques
Infection of insect cells with the baculovirus recombinants resulted in the appearance of novel approximately 45 kDa bands visible by Coomassie blue staining (Figure IA), that were not present in cells infected with a control baculovirus bE6short (Stacey et al, 1994)

Summary

Methods

The HPV-16 E2 open reading frame (coordinates 2756-3851; Seedorf et al, 1985) was amplified by polymerase chain reaction (PCR) from a genomic clone of HPV-16 (provided by H zur Hausen) using Vent DNA polymerase (New England Biolabs) according to the manufacturer's instructions. Primers were CGGATCCAACGATGGAGACTCTTT (forward) and CGGTACCGTGGATGCAGTATCAAG (reverse). The E2 start codon is shown in bold. The amplified fragment was digested with BamHI and KpnI and cloned into pBluescriptll (SK) (Stratagene). The insert was sequenced using an ABI 373 automated DNA sequencer (Applied Biosystems) and no coding changes were found. The insert was recovered as a BamHI-KpnI fragment and cloned into pVL941 and pBlueBacHisB (Invitrogen) to produce pVL-E2 and pBBH-E2 respectively

Results

Discussion

Conclusion