Abstract
In the present work, we developed the Fc-III tagged protein expression system for protein purification and detection. The Fc-III sequence encodes for a 13 residue peptide and this peptide is cyclized by disulfide bond formation when the fusion protein is expressed. The Fc-III-fusion proteins selectively bind to immunoglobulin Fc domains (IgG-Fc) expressed from E. coli. We showed the efficient purification of Fc-III tagged proteins by immobilized non-native IgG-Fc and the detection of the cellular locations of fusion proteins by fluorescent-conjugated IgG-Fc. Our results prove that Fc-III tagged protein expression system is a simple and efficient tool for protein purification and detection and is a useful addition to the biochemistry and proteomics toolbox.
Highlights
Protein tagging involves genetically grafting a peptide sequence onto a recombinant protein
Fc-III tagged or Histagged CA were incubated with immunoglobulin G (IgG)-Fc for half an hour at room temperature, and samples were centrifuged at 13 000 g and 100 ml sample was injected onto Superdex HR200 column and analyzed with the A KTA purifier 10 (GE Healthcare)
To generate Fc-III fusion protein, we appended the DNA sequence of Fc-III (GACTGTGCATGGCATCTTGGAGAACTCGTATGGTGTACT) onto either the 59 or 39 end of the human carbonic anhydrase II that was cloned into pET28a plasmid
Summary
Protein tagging involves genetically grafting a peptide sequence onto a recombinant protein. We engineered an Fc-III tagged fusion protein expression system. Fc-III tagged or Histagged CA were incubated with IgG-Fc for half an hour at room temperature, and samples were centrifuged at 13 000 g and 100 ml sample was injected onto Superdex HR200 column and analyzed with the A KTA purifier 10 (GE Healthcare).
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
