Development of Quantitative Real-Time PCR for Detecting Environmental DNA Derived from Marine Macrophytes and Its Application to a Field Survey in Hiroshima Bay, Japan

Masami Hamaguchi,Masakazu Hori,Hiromori Shimabukuro,Toshihiro Miyajima

doi:10.3390/w14050827

Abstract

The sequestration and storage of carbon dioxide by marine macrophytes is called blue carbon; this ecosystem function of coastal marine ecosystems constitutes an important countermeasure to global climate change. The contribution of marine macrophytes to blue carbon requires a detailed examination of the organic carbon stock released by these macrophytes. Here, we introduce a quantitative real-time polymerase chain reaction (qPCR)-based environmental DNA (eDNA) system for the species-specific detection of marine macrophytes. and report its application in a field survey in Hiroshima Bay, Japan. A method of qPCR-based quantification was developed for mangrove, seagrass, Phaeophyceae, Rhodophyta and Chlorophyta species, or species-complex, collected from the Japanese coast to investigate their dynamics after they wither and die in the marine environment. A trial of the designed qPCR system was conducted using sediment samples from Hiroshima Bay. Ulva spp. were abundant in coastal areas of the bay, yet their eDNA in the sediments was scarce. In contrast, Zostera marina and the Sargassum subgenus Bactrophycus spp. were found at various sites in the bay, and high amounts of their eDNA were detected in the sediments. These results suggest that the fate of macrophyte-derived organic carbon after death varies among species.

Highlights

Carbon sequestration and long-term storage in marine systems, including mangroves, salt marshes, seaweed beds and seagrass meadows, is a form of “blue carbon” and constitutes an important coastal ecosystem service for global climate-change mitigation [1–3]
The amplification efficiency, slope, and coefficient of determination of the dual-labeled probes (DLPs) and polymerase chain reaction (PCR) primers designed in this study were all within the range of the set criteria
For the internal standards for extrapolation, the following DLPs and PCR primers were designed using Crassostrea zhanjiangensis (CraZha-P: Cy5-CGCGGAAACTGTATCAGC-CACCT-BHQ3, CraZha-F: CAGCCATGCATTGGTTATAAT, CraZha-R:GGACTCAA-AACCTAAACGCA) and Ammodytes hexapterus (KitaIkana-Cytb-P: Cy5-CCGACAA-TTTCATCCCTGCCAACCCGCBHQ3, KitaIkana-CytB-F: CTTTTCAGCCCTAATCTAC-TGGGG, KitaIkana-CytB-R: TGATGTGGGGAGGAGTCACG) DNA, and the plasmids obtained by subcloning the PCR products were used

Summary

Introduction

Carbon sequestration and long-term storage in marine systems, including mangroves, salt marshes, seaweed beds and seagrass meadows, is a form of “blue carbon” and constitutes an important coastal ecosystem service for global climate-change mitigation [1–3]. It is necessary to develop tools that can verify the fate of macrophytederived organic carbon, in mangrove, salt marsh and seagrass systems, and the pathway in seaweed habitats along coastlines, which recent research has proven to be another important carbon sink [5–10]. Research on blue carbon science is relatively new in Japan, and details of carbon sequestration by macrophytes in the coastal environment are still not well understood. Environmental DNA (eDNA) technology [11–14] is especially useful for studying the contribution of macrophytes to the blue carbon sink. A few studies to date have directly compared these methods of eDNA detection, describing the advantages and disadvantages of each method [15–17]

Methods

Results

Discussion

Conclusion