Abstract
Reliable labelling of meat products is important in the food industry in order to ensure food safety, prevent fraud adulterations and avoid conflict with socio-religious practices. In Sri Lanka, wild boar meat is known to be substituted with pork to meet the demand. There are many court cases on illegal selling and transportation of wild boar meat. Thus, reliable methods to identify wild boar meat are necessitated. Therefore, the objective of the present study was to differentiate meat of wild boar from exotic and domestic swine using mitochondrial DNA markers. The entire mitochondrial DNA D-loop region was amplified using the forward primer, 5’CCAAGACTCAAGGAAGGAGA3’ and reverse primer, 5’GGCGCGGATACTTGCATGTG3’. From the sequence analysis several repetitive sequences of 5’CGTGCGTACA (10 bp) was observed indicating sequence heteroplasmy in porcine mitochondrial DNA D-loop region. Avoiding these repetitive sequences D-loop exhibited 17 polymorphic sites which enable differentiation of Sri Lankan wild boar from exotic and village pigs. Furthermore, a unique repeat of AAACCACAC (9 bp) was observed within the Sri Lankan wild boar samples analyzed. Targeting two polymorphic sites PCRRFLP analysis was performed, using forward primer 5’GTGCTACGAAAGCAGG3’ and same reverse primer followed by a simple restriction digestion using cost effective Dra 1 enzyme. Upon restriction digestion, wild boar produced two bands of 150 bp and 60 bp differing them from exotic and village pigs. This technique can be routinely applied to verify wild boar meat. Tropical Agricultural Research Vol. 23 (1): 11-20 (2011) DOI: http://dx.doi.org/10.4038/tar.v23i1.4627
Highlights
The increasing world population and the increasing demand for meat and meat products lower the per capita availability of protein of animal origin, resulting fraudulent substitution or adulteration of costly or highly demanded meat with cheaper ones (Koh et al, 1998)
Game meat is favored by many people due to diverse reasons such as intense flavor, specific texture, low fat and cholesterol content, lack of anabolic steroids and other drugs and increased awareness on organic products (La Neve et al, 2008; Hoffman & Wiklund, 2006)
The ordinance bans the sale or transport of wild boar meat, even that of wild boars killed under the exemption for animals that damage crops
Summary
The increasing world population and the increasing demand for meat and meat products lower the per capita availability of protein of animal origin, resulting fraudulent substitution or adulteration of costly or highly demanded meat with cheaper ones (Koh et al, 1998). Hindus do not consume beef due to Despite the high price, game meat is highly popular and highly demanded in meat industry, where substitutions and adulterations are commonly seen. Game animal hunting is popular in many countries, hunting of wild animals is restricted by law in Sri Lanka. Among the game meats in the country, wild boar meat is highly popular. The conservation status of wild boar is not classified as threatened or near threatened, hunting of wild boar is restricted in the country. When wild animals are hunted, phenotype markers are often destroyed or intentionally removed to conceal the species of origin, misleading the relevant authorities of wild life conservation (Rastogi et al, 2007). Identification of wild boar meat is important in making correct and fair decision in keeping with the country’s law and order
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
