Development of microsatellite markers for the resin-yielding, non-timber forest product species Boswellia serrata (Burseraceae).

Bhavani Shankar Maradani,Rajasekaran Chandrasekaran,Siddappa Setty,Ravikanth Gudasalamani

doi:10.1002/aps3.1180

Abstract

Premise of the Study Boswellia serrata (Burseraceae) is an economically important aromatic, gum‐resin–yielding, non‐timber forest tree species. Microsatellite markers were developed for B. serrata for the first time to study genetic diversity and population structure.Methods and ResultsA magnetic bead enrichment method was used to develop 16 microsatellite markers, of which 11 were polymorphic. The number of alleles per locus in the 60 individuals studied ranged from three to 10, and the levels of observed and expected heterozygosity ranged from 0.50 to 0.90 and 0.666 to 0.861, respectively. The primers successfully amplified in the congeneric species B. ovalifoliolata.ConclusionsThese microsatellite markers can be used to study the genetic variation and population structure of B. serrata and to provide crucial information on population and ecological issues for management and conservation of the species.

Highlights

PREMISE OF THE STUDY: Boswellia serrata (Burseraceae) is an economically important aromatic, gum-resin–yielding, non-t imber forest tree species
Boswellia serrata Roxb. ex Colebr. (Leung and Foster, 1996), one of four species in the genus Boswellia, is an endangered species that is found in dry deciduous forests of India, Pakistan, and Arabia (Ghorpade et al, 2010)
Boswellia serrata is a moderate-to large-sized tree found in the deciduous forests of Western Ghats, Eastern Ghats, Rajasthan, Gujarat, Uttar Pradesh, and in other dry and tropical regions of India

Summary

METHODS AND RESULTS

Fresh leaves of B. serrata were collected from three populations, Biligiri Ranganathaswamy Temple Tiger Reserve (BRT-TR), Male Mahadeshwara Hills Wildlife Sanctuary (MM Hills WLS), and Cauvery Wildlife Sanctuary (Cauvery WLS) of Western Ghats, India, to develop genetic markers and from one population of B. ovalifoliolata, from the Seshachalam foothills of Tirupati, Andhra Pradesh, India, to check cross-amplification (Appendix 1). Total genomic DNA of one sample from BRT-T R was digested with the restriction enzymes RsaI and XmnI (New England Biolabs, Ipswich, Massachusetts, USA). Digested products were ligated to double-stranded SNX linkers using a rapid DNA ligation kit (Fermentas International, Thermo Fisher Scientific, Bangalore, India) and amplified with SNX primers. The captured fragments containing microsatellite repeats were enriched by amplification with SNX linker-specific primers. Enriched fragments were transformed into E. coli strain CB-5α with the pTZ5RT vector (Thermo Fisher Scientific, Bangalore, India). The PCR fragments larger than 300 bp were sequenced using an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Waltham, Massachusetts, USA) at Chromous Biotech (Bangalore, India). Of the 42 primer pairs, 16 successfully amplified (Table 1) and were tested for polymorphism in 60 individuals of B. serrata and for cross-amplification in 10 individuals of B. ovalifoliolata (Table 2). Locus BS6 BS8 BS10* BS11 BS12* BS13 BS14 BS16 BS18* BS19* BS21* BS23 BS25 BS28 BS29 BS32

CONCLUSIONS

F: CTACGTATTGATGAGGCGGC R: GAGATCGATGGAATTGCTGGT F: CGCCTCAGCTCACCAGTAAT R

DATA ACCESSIBILITY