Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity

Chelsea M Byrd,Dennis E Hruby

doi:10.1186/1743-422x-2-63

Chelsea M Byrd, Dennis E Hruby

Open Access

https://doi.org/10.1186/1743-422x-2-63

Copy DOI

Abstract

Through the use of transient expression assays and directed genetics, the vaccinia virus (VV) I7L gene product has been implicated as the major maturational proteinase required for viral core protein cleavage to occur during virion assembly. To confirm this hypothesis and to enable a biochemical examination of the I7L cysteine proteinase, an in vitro cleavage assay was developed. Using extracts of VV infected cells as the source of enzyme, reaction conditions were developed which allowed accurate and efficient cleavage of exogenously added core protein precursors (P4a, P4b and P25K). The cleavage reaction proceeded in a time-dependent manner and was optimal when incubated at 25°C. I7L-mediated cleavage was not affected by selected inhibitors of metalloproteinases, aspartic acid proteinases or serine proteinases (EDTA, pepstatin, and PMSF, respectively), but was sensitive to several general cysteine proteinase inhibitors (E-64, EST, Iodoacetic acid, and NEM) as well as the I7L active site inhibitor TTP-6171 [C. Byrd et al., J. Virol. 78:12147–12156 (2004)]. Finally, in antibody pull down experiments, it could be demonstrated that monospecific αI7L serum depleted the enzyme activity whereas control sera including αG1L, directed against the VV metalloproteinase, did not. Taken together, these data provide biochemical evidence that I7L is a cysteine proteinase which is directly involved in VV core protein cleavage. Furthermore, establishment of this I7L-mediated in vitro cleavage assay should enable future studies into the enzymology and co-factor requirements of the proteolysis reaction, and facilitate antiviral drug development against this essential target.

Highlights

The Orthopoxviridae include vaccinia virus, camelpox, cowpox, ectromelia, monkeypox, raccoonpox, skunkpox, taterapox, volepox, and variola
All work demonstrating that I7L is the core protein proteinase has been done through transientexpression assays and the use of conditional lethal viruses in tissue culture [9,5,6,10]
The data obtained has indicated that I7L is essential for these processing activities, it Plasmids The A10L (P4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCATGGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACAGAGTC-3'), digested with NcoI and XhoI, and cloned into the pTM1 vector, yielding pTM-P4a which utilizes a T7 promoter for expression

Summary

Introduction

The Orthopoxviridae include vaccinia virus, camelpox, cowpox, ectromelia, monkeypox, raccoonpox, skunkpox, taterapox, volepox, and variola. Viruses in this family are the cause of numerous diseases including smallpox (variola), and recent human outbreaks of monkeypox. The genome of VV is predicted to encode over 200 open reading frames. VV expresses its genetic information in three stages, as early, intermediate, and late genes. The early genes, which account for approximately half of the genome and are transcribed prior to DNA replication, encode many of the proteins involved in viral DNA replication and intermediate gene expression. The intermediate genes, of which only a handful have been identified, are expressed after the onset of DNA replication, and encode proteins that (page number not for citation purposes)

Methods

Results

Discussion

Conclusion