Abstract
Background Caseous lymphadenitis (CLA) is a disease caused by the bacteria Corynebacterium pseudotuberculosis which affects small ruminants such as sheeps and goats, leading to severe economic losses. The development of more sensitive and specific diagnoses showing effectiveness on asymptomatic animals is essential for disease’s control. This study purposes the use of the recombinant protein CP1957 of C. pseudotuberculosis in indirect ELISA using sheep sera.
Highlights
Caseous lymphadenitis (CLA) is a disease caused by the bacteria Corynebacterium pseudotuberculosis which affects small ruminants such as sheeps and goats, leading to severe economic losses
E. coli BL21 Star cells were transformed with the pAE/1957 vector for the expression of rCP1957 protein, the induction was performed by the addition of IPTG 1mM to the culture media
For indirect ELISA, the purified rCP1957 was utilized as antigen in a concentration of 1μg/mL
Summary
Caseous lymphadenitis (CLA) is a disease caused by the bacteria Corynebacterium pseudotuberculosis which affects small ruminants such as sheeps and goats, leading to severe economic losses. Methods The amplification of the cp1002_1957 gene was performed using the primers F5’ CGCGGATCCGGGCCTCGCGACTGG 3’ and R5’ CCGGAATTCTTACCAGGCGTTCATAACGT 3’. The cp1002_1957 gene was cloned in the BamHI e EcoRI sites of the pAE vector.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have