Development of a Coupling‐Phase SCAR Marker Linked to the Ur‐7 Rust Resistance Gene and Its Occurrence in Diverse Common Bean Lines

Abstract

Bean rust, caused by Uromyces appendiculatus (Pers.:Pers.) Unger, is an important disease of common bean (Phaseolus vulgaris L.). A coupling‐phase random amplified polymorphic DNA (RAPD) marker OAD12.550 previously was identified to be linked (no recombination) to Ur‐7 of Middle American (MA) origin for specific rust resistance in the common bean cross of Great Northern (GN) 1140 × GN Nebr. #1. However, a sequence characterized amplified region (SCAR) marker for Ur‐7 present in GN1140 has not been reported. Our objectives were to convert the RAPD marker OAD12.550 most tightly linked to Ur‐7 to a SCAR marker SOAD12.537 for use as a marker‐assisted selection tool, and survey the presence or absence of the SCAR marker SOAD12.537 in 90 MA and Andean bean genotypes for determining the genetic relationship of Ur‐7 with Ur‐6 The coupling‐phase SCAR marker SOAD12.537 based on a specific forward (5′‐AAGAGGGCGTGAGATCGTCG‐3′) and reverse (5′‐AAGAGGGCGTCTTGAAGGTT‐3′) primer pair showed no recombination with Ur‐7 in an F2 population of the GN1140 × Nebr. #1 cross. The SCAR marker was also present in pinto US‐5 from which the rust resistance of GN1140 was derived and in the closely related pinto US‐14. The cosegregating SCAR marker identified MA pinto bean cultivars/lines Olathe, Bill Z, Apache, Montrose, BelDak‐RR‐1 and‐2, and CO 12783 that have rust resistance gene Ur‐6 and also have Ur‐7, identified in earlier literature as Urc, due to presence of the marker. Other cultivars/lines with Ur‐6 such as Weihing, Burke, Kodiak, Topaz, Golden Gate Wax, BelMiNeb 1–13, BelDakMi 1–23, and other Colorado breeding lines lack Ur‐7 because of absence of the SCAR marker for the MA gene. This SCAR marker linked to Ur‐7 on linkage group 11 of the core P. vulgaris linkage map can identify a phenotypically hidden resistance gene, and along with markers for other rust resistance genes, can be utilized to pyramid multiple genes for more durable rust resistance.