Abstract

Premise of the StudyExpressed sequence tag–simple sequence repeat (EST‐SSR) markers were isolated for Vriesea carinata, an endemic bromeliad from the Brazilian Atlantic Forest. These SSR loci may be used to investigate the genetic diversity and population structure of this species and related bromeliads.Methods and ResultsBased on the transcriptome data of V. carinata, 30 primer pairs were designed and selected for initial validation. Of these primer pairs, 16 generated suitable SSR loci in 69 individuals. The number of alleles per locus ranged from one to 13; the levels of observed and expected heterozygosity per locus ranged from 0.000 to 1.000 and from 0.000 to 0.935, respectively. All loci produced heterologous amplification. Transferability of the loci was tested in 15 species belonging to three Bromeliaceae subfamilies.ConclusionsThe developed EST‐SSR markers revealed polymorphism in the four studied populations and could be useful to investigate the genetic diversity of V. carinata and related species. The markers may also be suitable for novel gene annotation and discovery.

Highlights

  • PREMISE OF THE STUDY: Expressed sequence tag–simple sequence repeat (EST-­SSR) markers were isolated for Vriesea carinata, an endemic bromeliad from the Brazilian Atlantic Forest

  • The developed expressed sequence tag (EST)-­SSR markers revealed polymorphism in the four studied populations and could be useful to investigate the genetic diversity of V. carinata and related species

  • Vriesea carinata Wawra is an epiphyte or terrestrial species that exists in mesophilic environments and well-­ preserved habitats with high humidity distributed along the Atlantic Forest

Read more

Summary

METHODS AND RESULTS

Total RNA was isolated from V. carinata leaves as described by Guzman et al (2013). RNA quality was assessed by 1% agarose gel electrophoresis and quantified by the Thermo Scientific NanoDrop Lite Spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). Based on the transcriptome data of V. carinata, 30 primer pairs were designed and tested, of which 16 yielded suitable SSR loci in 69 individuals among the four studied populations (Tables 1, 2). Note: — = index could not be calculated; A = number of alleles; FIS = inbreeding coefficient; He = expected heterozygosity; Ho = observed heterozygosity; N = number of plants sampled; NT = locus not tested for the population (due to problems with the DNA of some individuals, the last isolated loci could not be tested in these populations). Approximately 81% amplified in all five individuals tested (Table 4) These loci amplified in some species belonging to subfamilies other than Tillandsioideae, which suggests their potential utility in genetic studies of populations involving other bromeliad subfamilies. Voucher information concerning the species investigated is listed in Appendix 1

CONCLUSIONS
F: AACTTGTCTATGTCTAAAGGAATGG R: ACTCTGCGGCTGTTCTTCTC F: CCGTAGGCGACGATAGAGAG R
DATA ACCESSIBILITY
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call