Abstract
Termites and ants contribute more to animal biomass in tropical rain forests than any other single group and perform vital ecosystem functions. Although ants prey on termites, at the community level the linkage between these groups is poorly understood. Thus, assessing the distribution and specificity of ant termitophagy is of considerable interest. We describe an approach for quantifying ant-termite food webs by sequencing termite DNA (cytochrome c oxidase subunit II, COII) from ant guts and apply this to a soil-dwelling ant community from tropical rain forest in Gabon. We extracted DNA from 215 ants from 15 species. Of these, 17.2 % of individuals had termite DNA in their guts, with BLAST analysis confirming the identity of 34.1 % of these termites to family level or better. Although ant species varied in detection of termite DNA, ranging from 63 % (5/7; Camponotus sp. 1) to 0 % (0/7; Ponera sp. 1), there was no evidence (with small sample sizes) for heterogeneity in termite consumption across ant taxa, and no evidence for species-specific ant-termite predation. In all three ant species with identifiable termite DNA in multiple individuals, multiple termite species were represented. Furthermore, the two termite species that were detected on multiple occasions in ant guts were in both cases found in multiple ant species, suggesting that ant-termite food webs are not strongly compartmentalised. However, two ant species were found to consume only Anoplotermes-group termites, indicating possible predatory specialisation at a higher taxonomic level. Using a laboratory feeding test, we were able to detect termite COII sequences in ant guts up to 2 h after feeding, indicating that our method only detects recent feeding events. Our data provide tentative support for the hypothesis that unspecialised termite predation by ants is widespread and highlight the use of molecular approaches for future studies of ant-termite food webs.
Highlights
Termites and ants are ubiquitously abundant in tropical rain forests around the world [1,2,3], with both groups being functionally important [4]
We clustered ant sequences in the same way. For both taxa we visually identified the percentage cut-off points that corresponded to the ‘barcode gap’ [41]
An ant that had been recently observed to carry a termite showed a strong c oxidase subunit II (COII)-length band, as did a whole termite (1/1 sample for each). These results indicate that fragments of COII sufficient in length to be detected using PCR remain in ant guts up to 2 h after feeding
Summary
Termites and ants are ubiquitously abundant in tropical rain forests around the world [1,2,3], with both groups being functionally important [4]. We investigate the potential for sequencing entire individual ants, including their gut contents, as a method for determining the rates and specificities of ant predation on subterranean termites. We conducted PCR on the resulting DNA using termite-specific cytochrome c oxidase subunit II (COII) primers (Sequences, 5’ to 3’: Modified A-tLeu: CAGATAA GTGCATTGGATTT, B-tLys: GTTTAAGAGACCAGTACTTG; [37]).
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
