Abstract
In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.
Highlights
About 80% of the etiologic agents involved in insect diseases are fungi, encompassing 90 genera and more than 700 species
We found that the sequenced regions of the products from the Brazilian M. a. anisopliae strains E9, B/Vi and C differed from those of the Australian M. a. anisopliae strain 14 and this allowed us to design a specific primer for each of these distinct groups based on the location of the differences in the ITS1 – 5.8 S – ITS2 sequences
The polymerase chain reaction (PCR) products digested with the restriction enzymes Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A I (Figure 1, Table 2) showed distinct restriction fragment length polymorphism (RFLP) patterns for different strains
Summary
About 80% of the etiologic agents involved in insect diseases are fungi, encompassing 90 genera and more than 700 species. Several research groups have verified the entomopathogenicity of the Deuteromycete fungi Metarhizium anisopliae, which has become an important biocontrol agent used in the microbial control of insect pests. The sugarcane spittlebug (Mahanarva posticata) (Homoptera, Cercopidae) causes serious losses in sugarcane crops but has been successfully controlled in northeastern Brazil using biocontrol by M. anisopliae, which has been used in the biocontrol of other spittlebug genera (Aenolamia, Deois and Zulia) infesting pasture grasses (Onofre et al, 2002). The production of mycoinsecticides is very simple, but their use as biocontrol agents depends critically on the standardization of the production runs and the stability of the mycoinsecticide under field conditions where the formulation must allow the fungus to maintain its virulence. It is important to monitor how mycoinsecticides disseminate and survive in the environment after application (Hegedus and Khachatourians, 1996a)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
