Abstract
The aim of this study is to evaluate the occurrence of methicillin-resistant Staphylococcus aureus (MRSA) in dairy desserts samples and to investigate the antimicrobial resistance and molecular characteristics of these strains using PCR. A total of 120 samples comprising sweetened whipped cream, mehallabeia, ice cream and rice with milk were randomly collected from confectioneries, dairy shops, primitive restaurants and supermarkets in Sohag city, Egypt (30 samples each) and examined for presence of S. aureus. The results revealed that S. aureus could be detected in 23.3% of sweetened whipped cream, 6.7% of mehallabeia, 16.7% of ice cream and 3.3% of rice with milk samples. The results of antibiogram testing revealed that the highest percentage 9 (7.5%) of S. aureus isolates showed a complete resistance and 4(3.3%) showed intermediate resistance. However, the lowest percentage 2(1.7%) of the isolates were sensitive to methicillin. Eight out of nine strains that showed complete resistance using antibiotic sensitivity test identified as MRSA by detection of mecA gene by PCR (five from sweetened whipped cream, one from mehallbeia and two from ice cream samples). Furthermore, some classical enterotoxins gene profile of complete resistant strain were investigated by using M-PCR. The enterotoxins were detected in four strains only, and three different toxinotypes were recorded. The most frequent ones were “sea” gene, and followed by sed & seb from sweetened whipped cream and ice cream samples, while no sec gene could be detected from all samples. It is emphasized that the presence of S. aureus and their SEs genes in dairy desserts may be regarded as a potential risk for human health.
Highlights
Staphylococcus aureus is involved in a wide variety of humans and animals diseases and its pathogenicity is mainly related to a combination of toxin-mediated virulence, invasive capacity, and antibiotic resistance (Argudin et al, 2010)
B) SEs (S. aureus enterotoxins) gene detection: Suspected methicillin-resistant Staphylococcus aureus (MRSA) isolates were investigated for the presence of genes coding for selected SEs, according to what described by Mehrotra et al (2000) by using multiplex polymerase chain reaction (PCR) protocols (MPCR)
Incidence of S. aureus in dairy desserts samples: From the current study, it is clear that 15 (12.5%) out of 26 Staphylococcal spp. isolated from total 120 samples were identified as S. aureus which were distributed in, 7(23.3%), 2(6.7%), 5(16.7%) and 1(3.3%) of sweetened whipped cream, mehallbeia, ice cream and rice with milk examined samples, respectively (Tables 1&2).While a higher percentage (52%) of S. aureus isolated from dairy desserts was recorded by Ertas et al (2010)
Summary
Staphylococcus aureus is involved in a wide variety of humans and animals diseases and its pathogenicity is mainly related to a combination of toxin-mediated virulence, invasive capacity, and antibiotic resistance (Argudin et al, 2010). In 2009, the European Food Safety Authority underlined the increasing concern for Public Health represented by the presence of methicillin-resistant S. aureus (MRSA) in food producing animals, and recommended that further work should be performed on sampling, detection and quantification of MRSA carriage in both humans and animals, as well as on the contamination of food and the environment (EFSA, 2009). 4. Molecular characterization: a) PCR detection of MRSA: Suspected MRSA (positive methicillin resistant of sensitivity test) isolates were further confirmed by molecular method. B) SEs (S. aureus enterotoxins) gene detection: Suspected MRSA isolates were investigated for the presence of genes coding for selected SEs (sea, seb, sec, sed), according to what described by Mehrotra et al (2000) by using multiplex PCR protocols (MPCR). Oligonucleotide sequence (5′ → 3′) 5′ TAGAAATGACTGAAC GTCCG ′3 5′ TTGCGATCA ATGTTACCGTAG ′3 5′ TTGGAAACGGTTAAAACGAA′3 5′ GAACCTTCCCATCAAAAACA ′3 5′ TCGCATCAAACTGACAAACG ′3 5′ GCGGTACTCTATAAGTGCC ′3 5′ GACATAAAAGCTAGGAATTT ′3 5′ AAATCGGATTAACATTATCC ′3 5′ CTAGTTTGGTAATATCTCCT ′3 5′ TAATGCTATATCTTATAGGG ′3
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
