Designing Primers with a Plant Signal Peptide to Enhance the Expression of GBA1 in Transgenic Soybean Plants

Zainab Tuama Aldahlee

doi:10.21123/bsj.2021.18.4.1173

Abstract

Transgenic plants offer advantages for the manufacture of recombinant proteins with terminalmannose residues on their glycan chains. So plants are chosen as source of pharmaceutical products and forthe development of alternative expression systems to produce recombinant lysosomal enzymes. In thepresent study the sequence of the natural cDNA encoding for the human lysosomal enzymeglucocerebrosidase (GCD) was modified to enhance its expression in soybean plants. The glucocerebrosidasegene signal peptide was substituted with that signal peptide for the Arabidopsis thaliana basic endochitinasegene to support the co-translational translocation into the endoplasmic reticulum (ER), and the storagevacuole. So, targeting signal from tobacco chitinase A, to facilitate GCD trafficking from the ER to thestorage vacuole, appropriate primers were designed containing both an ER and vacuolar targeting signals,(VTS). Those primers were used for PCR amplification of the human GBA gene (Hu-GBA) gene fromconstructed PGEM-GBA plasmid which was cloned in the plant expression vector pCAMBIA1304. Theresulted construct was transported in Agrobacterium tumefaciens strain LBA4404 and was used fortransformation of cotyledon explants. After 5-day of seedling, cotyledons were cut and used as explants.After infection and co-cultivation, hygromycin B was added in selection media as a selective agent for thetransformants cotyledons. The presence of the Hu-GBA transgene in the genomes of transgenic plants wasdetermined by polymerase chain reaction PCR as a band of size1587 bp. The GBA mRNA expression inmodified soybean was detected by qRT-PCR compared with control GBA mRNA.

Highlights

The concept of utilizing plants for the production of valuable pharmaceuticals, such as vaccines and recombinant proteins, was introduced over twenty years ago (1)
During the development of the present treatment for gaucher disease, the terminal sugars are sequentially removed from the carbohydrate chain of GCD (11) Three different glycosidases involved the formation of a glycoprotein with terminal mannose residues in order to target macrophages which bear mannose receptors (12).While many plant systems have been utilized for backing the expression of heterogeneous proteins, we thought that soybeans may be the most effective of these systems (13)
GBA complementary DNA (cDNA) was modified a designed forward primer containing DNA coding sequences for the endoplasmic reticulum (ER) targeting signal encoded by the basic endochitinase gene (Arabidopsis thaliana), ATGAAGACTAATCTTTTTCTCTTTCTCATCTT TTCACTTCTCCTATCATTATCCTCGGCCGAA TTC which has been communicated to increase the accumulation of recombinant protein in plant tissues, and a reverse primer containing the vacuolar targeting signal GATCTTTTAGTCGATACTATG from tobacco chitinase A

Summary

Introduction

The concept of utilizing plants for the production of valuable pharmaceuticals, such as vaccines and recombinant proteins, was introduced over twenty years ago (1). Recombinant proteins in plant will be modified when targeted for retention within the "endoplasmic reticulum (ER)" by the addition of high-mannose-type N-glycans (4). During the development of the present treatment for gaucher disease, the terminal sugars are sequentially removed from the carbohydrate chain of GCD (11) Three different glycosidases involved the formation of a glycoprotein with terminal mannose residues in order to target macrophages which bear mannose receptors (12).While many plant systems have been utilized for backing the expression of heterogeneous proteins, we thought that soybeans may be the most effective of these systems (13). Soybean seeds are traditionally considered highly oiled and proteinaceous seeds, protein represents 38% of the dry mass of soybeans, and is considered one of the richest known natural sources of protein Offered this high protein content (15), transgenic proteins can be expressed at levels exceeding one milligram in a single soybean seed. The aim of this study is to confirm the success of the designed primers with plant signal peptide in amplified the GBA gene and the expression of this gene in soybean plant

Objectives

Methods

Results

Discussion

Conclusion