Abstract
Major histocompatibility complex (MHC) class II molecules are membrane-anchored heterodimers on the surface of antigen-presenting cells that bind the T cell receptor, initiating a cascade of interactions that results in antigen-specific activation of clonal populations of T cells. Susceptibility to multiple sclerosis is associated with certain MHC class II haplotypes, including human leukocyte antigen (HLA) DR2. Two DRB chains, DRB5*0101 and DRB1*1501, are co-expressed in the HLA-DR2 haplotype, resulting in the formation of two functional cell surface heterodimers, HLA-DR2a (DRA*0101, DRB5*0101) and HLA-DR2b (DRA*0101, DRB1*1501). Both isotypes can present an immunodominant peptide of myelin basic protein (MBP-(84-102)) to MBP-specific T cells from multiple sclerosis patients. We have previously demonstrated that the peptide binding/T cell recognition domains of rat MHC class II (alpha1 and beta1 domains) could be expressed as a single exon for structural and functional characterization; Burrows, G. G., Chang, J. W., Bächinger, H.-P., Bourdette, D. N., Wegmann, K. W., Offner, H., and Vandenbark A. A. (1999) Protein Eng. 12, 771-778; Burrows, G. G., Adlard, K. L., Bebo, B. F., Jr., Chang, J. W., Tenditnyy, K., Vandenbark, A. A., and Offner, H. (2000) J. Immunol. 164, 6366-6371). Single-chain human recombinant T cell receptor ligands (RTLs) of approximately 200 amino acid residues derived from HLA-DR2b were designed using the same principles and have been produced in Escherichia coli with and without amino-terminal extensions containing antigenic peptides. Structural characterization using circular dichroism predicted that these molecules retained the antiparallel beta-sheet platform and antiparallel alpha-helices observed in the native HLA-DR2 heterodimer. The proteins exhibited a cooperative two-state thermal unfolding transition, and DR2-derived RTLs with a covalently linked MBP peptide (MBP-(85-99)) showed increased stability to thermal unfolding relative to the empty DR2-derived RTLs. These novel molecules represent a new class of small soluble ligands for modulating the behavior of T cells and provide a platform technology for developing potent and selective human diagnostic and therapeutic agents for treatment of autoimmune disease.
Highlights
The pathogenesis of a variety of human diseases including multiple sclerosis, rheumatoid arthritis, diabetes, autoimmune uveitis, transplant rejection, chronic beryllium disease, and graft-versus-host disease appear to involve antigen-specific CD4ϩ T cells [1,2,3,4,5]
Toward the long term goal of targeted antigen-driven immunosuppression of pathogenic T cells, we have developed a family of novel recombinant TCR ligands (RTLs) that consist of the 1 and ␣1 domains of human MHC class II molecules
We developed our rat RTL constructs for clinical studies, treating experimental autoimmune encephalomyelitis, a paralytic, inflammatory, and sometimes demyelinating disease mediated by CD4ϩ T cells specific for central nervous system myelin components, including myelin basic protein (MBP)
Summary
Homology Modeling—Sequence alignment of MHC class II molecules from human, rat, and mouse species provided a starting point for our studies, as previously described [9]. 5 l of each purified amplification product were added to a 50-l primer-free PCR reaction and cycled 5 times at an annealing temperature of 55 °C. The 90-base pair DNA sequence encoding peptide Ag and linker was inserted at position 16 of the RTL300 DNA construct in a three-step PCR reaction using Taq DNA polymerase (Promega). The region from the start of the T7 priming site of the pET21d(ϩ) plasmid to the point of insertion within the hu1␣1 (RTL300) sequence was amplified with the primers 5Ј-gctagttattgctcagcgg-3Ј (T73) and 5Ј-aggctgccacaggaaacgtgggcctccacctccagagcctcggggcactagtgagcctccacctccacgcggggtaacgatgtttttgaagaagtgaacaaccgggttttctcgggtgtcccccatggtaat-3Ј (huMBP-(85–99)Lig). 5 l of each purified amplification product was added to a primer-free “annealextend” PCR reaction mix and cycled 5 times at an annealing temperature of 50 °C. The transition curves were normalized to the fraction of the peptide folded (F) using the standard equation F ϭ (U Ϫ Uu)/(Un Ϫ Uu), where Un and Uu represent the ellipticity values for the fully folded and fully unfolded species, respectively, and U is the observed ellipticity at 222 nm
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have