Abstract
Interleukin-15 (IL15) is one of the most important cytokines currently being considered for cancer therapy applications. It is thought that by administering IL15 in complex with its cognate receptor alpha chain (IL15Rα) its biological activity could be increased manifold. We produced a fusion protein of mouse IL15Rα and the F8 antibody, that targets the alternatively-spliced extra-domain A (EDA) of fibronectin, which is overexpressed in many types of cancer. The fusion protein F8IL15Rα was cloned, expressed and characterized in vitro and its ability to bind to mouse IL15 was assessed with both size exclusion chromatography (SEC) and surface plasmon resonance (SPR) experiments. Furthermore, mouse and human IL15 and their corresponding Fc fused IL15Rα subunits were purchased, characterized and used to compare the capacity of F8IL15Rα to generate complexes. Surprisingly, none of the IL15Rα fusion proteins showed IL15 complexation on SEC. However, on SPR, F8IL15Rα displayed the ability to bind IL15. In a cell-based activity assay none of the IL15Rα fusions were able to increase cellular proliferation in combination with IL15 compared to IL15 alone. A better understanding of the molecular requirements for effective IL15 signalling are likely to be important for the development of IL15-based biopharmaceuticals.
Highlights
Interleukin-15 (IL15) is a cytokine that has been hailed as one of the most promising agents in the fight against cancer.[1, 2] It is produced by dendritic cells, monocytes, fibroblasts and epithelial cells and has similar roles to those of interleukin-2 (IL2), being involved in T cell, B cell and natural killer (NK) cell proliferation.[3, 4] while IL2 supports regulatory T cell (Treg) maintenance and activation-induced cell death (AICD), leading to apoptosis of stimulated T cells as well as induction of T cell tolerance, IL15 does not seem to have a major effect on Tregs and inhibits AICD.[5]
The goal of this study was to design and produce a novel fusion protein (F8IL15Rα), consisting of the F8 antibody in diabody format fused to the extracellular portion of mouse IL15Rα, with the plan to non-covalently assemble the product with recombinant IL15 and use the resulting complex for tumour targeting applications
The F8 antibody in diabody format and linked C-terminally with a 15-amino-acid linker (SSSSG)3 to the extracellular portion of mouse IL15Rα(33–205), which in turn was linked C-terminally to mouse IL15, was ordered from Genscript (United States) in the mammalian expression vector pcDNA3.1(+).The desired construct was generated with polymerase chain reaction (PCR) by amplifying the F8IL15Rα region with the primer pair 5’ CCCGCTAGCGTCGACCATGGGCTGGAGCCTGATCCTCCT GTTCCTCGTCGCTGTGGC 3’ and 5’ CCCCGCGAATTCTCATTAAGCTATTTCGTCATTT TGGAACTGTGGGGAGAAATCTCTG 3’, adding a C-terminal stop codon and restriction site EcoRI
Summary
Interleukin-15 (IL15) is a cytokine that has been hailed as one of the most promising agents in the fight against cancer.[1, 2] It is produced by dendritic cells, monocytes, fibroblasts and epithelial cells and has similar roles to those of interleukin-2 (IL2), being involved in T cell, B cell and natural killer (NK) cell proliferation.[3, 4] while IL2 supports regulatory T cell (Treg) maintenance and activation-induced cell death (AICD), leading to apoptosis of stimulated T cells as well as induction of T cell tolerance, IL15 does not seem to have a major effect on Tregs and inhibits AICD.[5] is IL15 involved in the generation of long-lasting CD8+ memory T cells, but studies in animals have shown a more desirable safety profile for IL15 compared to IL2, as no capillary leak syndrome was observed. Is IL15 involved in the generation of long-lasting CD8+ memory T cells, but studies in animals have shown a more desirable safety profile for IL15 compared to IL2, as no capillary leak syndrome was observed. [6, 7] Taking all of this into account, IL15 is thought to be an even more suitable candidate
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
