Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines

Zitong Gao,Xiaoyue Wang,Jianping Han,Steven G Newmaster,Shilin Chen,Subramanyam Ragupathy,Jingyuan Song,Yang Liu

doi:10.1038/s41598-017-05892-y

Abstract

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Highlights

Lonicerae japonicae Flos (Jinyinhua) derived from L. japonica is one of the most commonly used traditional Chinese medicines and is widely planted in China, Japan, Korea and Southeast Asia[11] for the extraction of the main active medicinal components with high levels: chlorogenic acid (CGA)[12, 13]
The current quality assurance (QA) standard test for Lonicerae japonicae Flos products is utilizes analytical chemistry in detecting the content of CGA according to the current Chinese Pharmacopeia regulations[24]
There is great variation (5% to 95%) in the CGA content within Lonicerae japonicae Flos extracts in the market, which has become the basis for determining product prices

Summary

Introduction

Lonicerae japonicae Flos (Jinyinhua) derived from L. japonica is one of the most commonly used traditional Chinese medicines and is widely planted in China, Japan, Korea and Southeast Asia[11] for the extraction of the main active medicinal components with high levels: chlorogenic acid (CGA)[12, 13]. Hou et al used ITS2 to identify Lonicerae japonicae Flos from Lonicerae Flos[19], but this method is not feasible for extracts and CPMs where the DNA is heavily degraded into fragments that are smaller than what has been defined as a plant barcode region: >260 bp in ITS2 and >500 bp in rbcL. DNA barcoding is somewhat antiquated as it is by a definition limited to the use of specific DNA barcode regions using Sanger sequencing, followed by species assignments within the barcode of life library, which has limited coverage for medicinal plant species and very poor estimates of intraspecific variation This presents considerable impediments to the commercial use because the defined plant barcode regions are known to have low PCR and sequence success rates for processed samples[4, 22]. We validated these methods in detecting authentic species of Lonicerae japonicae Flos (L. japonica Thunb.; Jinyinhua) and targeted adulterant species including Eucommiae Folium (E. ulmoides Oliv.) and Lonicerae Flos (4 Lonicera spp.) by testing commercial market samples including 1) 20 extracts and 2) 47 CPMs

Objectives

Methods

Results

Conclusion