Abstract

By screening of a lambda gt11 library from Plasmodium falciparum genomic DNA with an antiserum raised against a 41-kDa protein band, which was shown to confer protective immunity to monkeys, the phage clone 41-3 was identified. The entire 41-3 gene was isolated, and its coding regions were determined by amplification and sequencing of 41-3 specific mRNA fragments. The 41-3 gene has a complex structure consisting of nine exons, encoding 375 amino acids in total with a calculated molecular weight of 43,400. Provided that the N-terminal hydrophobic residues function as signal sequence which is cleaved off, the molecular weight of the 41-3 protein decreases to 41,200 and could therefore be considered to be a component of the protective Mr = 41,000 protein band. Indeed, a 41-kDa protein could be detected by Western blot analysis using antisera raised against different recombinant expression products of the 41-3 gene. We furthermore demonstrate an alternative splice process for the mRNA precursor transcribed from the 41-3 gene to yield at least three distinct mRNAs. The major splice product carries all exons E1 to E9, whereas at least two minor 41-3 mRNA species can be identified which show deletions in the region between exons E5 and E7. The possible role of this differential splice process for the parasite is discussed.

Highlights

  • MATERIALS ANDMETHODS falciparum genomic DNA with an antiserum raised against a 41-kDa protein band, which was shown to confer protective immunity to monkeys, the phage clone 41-3 was identified

  • The mung molecular weight of the 41-3 protein decreases to bean nuclease-digestedDNA wassized by agarose gel electrophoresis, 41,200 and couldtherefore be considered to be a component of the protective M, = 41,000 protein band

  • We were not able to detect specific mRNAs and could not assign the open reading frames (ORFs) to expressed genes.the results indicate that these sequences do not belong to the41-3 gene

Read more

Summary

RESULTS

Preceding the initiation codon are in agreement with the 5‘ consensus sequence 5’ AAAA 3‘ determined from 22 P. falci-. Isolation of a Xgtll Phage Clone Recognizedby an Antiserum parum sequences [17]. Raised against the Protective 41-kDa Protein Band-As pre- At the 3‘ end, there is no evidence either for additional viously described, screening of a genomic Xgtll library from exons. P. fakiparum with an antiserum raised against the 41-kDa shown to terminate-thecoding region for a sequence amplified protein bandwhich wasshown to confer protective immunity from mRNA using the oligonucleotidesp and p12. Furtherto Saimiri monkeys [1]yielded 16phage clones carrying insert more, the 3‘ noncoding region ranging from position 3040 to. Nomic sequences flanking the sequence of the insert DNA of At the 5’ end, 537 bp upstream to the proposed initiation phage clone 41-3 that covers the residues from position 1715 codon of the 41-3 gene, the isolated genomic sequencecarries.

E6 E7 EB E9
E2 El E8 E8 E4 E4
86 AATTCATTATATATTTATAGfGGA
Findings
DISCUSSION
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call