Deficiency of eIF4B Increases Mouse Mortality and Impairs Antiviral Immunity.

Biao Chen,Yuhai Chen,Xuefei Wang,Ji-Long Chen,Yun Ma,Guijie Guo,Guoqing Wang,Shasha Liu,Shile Huang,Meng Xiao,Kul Raj Rai,Yingying Li

doi:10.3389/fimmu.2021.723885

Abstract

Eukaryotic translation initiation factor 4B (eIF4B) plays an important role in mRNA translation initiation, cell survival and proliferation in vitro. However, its function in vivo is poorly understood. Here, we identified that eIF4B knockout (KO) in mice led to embryonic lethality, and the embryos displayed severe liver damage. Conditional KO (CKO) of eIF4B in adulthood profoundly increased the mortality of mice, characterized by severe pathological changes in several organs and reduced number of peripheral blood lymphocytes. Strikingly, eIF4B CKO mice were highly susceptible to viral infection with severe pulmonary inflammation. Selective deletion of eIF4B in lung epithelium also markedly promoted replication of influenza A virus (IAV) in the lung of infected animals. Furthermore, we observed that eIF4B deficiency significantly enhanced the expression of several important inflammation-associated factors and chemokines, including serum amyloid A1 (Saa1), Marco, Cxcr1, Ccl6, Ccl8, Ccl20, Cxcl2, Cxcl17 that are implicated in recruitment and activation of neutrophiles and macrophages. Moreover, the eIF4B-deficient mice exhibited impaired natural killer (NK) cell-mediated cytotoxicity during the IAV infection. Collectively, the results reveal that eIF4B is essential for mouse survival and host antiviral responses, and establish previously uncharacterized roles for eIF4B in regulating normal animal development and antiviral immunity in vivo.

Highlights

Protein synthesis is a fundamental and intricate biological process in eukaryotic cells, which is crucial for cell survival, growth, proliferation, migration and differentiation [1, 2]
The generated eIF4Bf/f mice were initially crossed to a transgenic line expresses Flp recombinase to eliminate Frt-flanked neomycin cassette. Eukaryotic translation initiation factor 4B (eIF4B) conventional knockout mice were generated by crossing eIF4Bf/f mice with EIIA-cre transgenic mice. eIF4B conditional knockout mice eIF4Bf/f UBC-CreERT2 were generated by crossing eIF4Bf/f mice with UBC-CreERT2 transgenic mice. eIF4Bf/f mice were mated with SPC-rtTA/ Teto-Cre mice to obtain eIF4Bf/f SPC-rtTA/Teto-Cre mice in which EIF4B gene is conditionally inactivated in lung epithelium by doxycycline treatment. eIF4B+/+ and eIF4B+/- mice were genotyped by PCR using genomic DNA isolated from tail tips with primers: eIF4B-P1 (5’- TCTGTGTAG CCCTGGCTA TGCTAA -3’), eIF4B-P2 (5’- ATCAGCGCTGTACGCTTAC CACG -3’), eIF4B-P3 (5’- TTCCATTGCAATCACTGTACC TG -3’)
Further studies revealed that eIF4B-/- embryos died between E14.5 and E16.5, showing severe embryonic dysplasia, compared with eIF4B+/- and wild type (WT) embryos (Figures 1G–I)

Summary

Introduction

Protein synthesis is a fundamental and intricate biological process in eukaryotic cells, which is crucial for cell survival, growth, proliferation, migration and differentiation [1, 2]. Translation initiation is a major rate-limiting step of protein synthesis and is often the effective target for complex regulatory mechanisms [3, 4]. It has been shown that eIF4B participates in the recruitment of ribosome in the process of eukaryotic translation initiation, and plays a key role in stimulating the RNA helicase activity of eIF4A [3, 5, 12,13,14], which results in more effective unwinding of the complex mRNA secondary structure in the 5’ untranslated region and translation of these mRNAs [15]. EIF4B is a crucial protein in regulating translation initiation

Methods

Results

Conclusion