Decreased ALKBH5, FTO, and YTHDF2 in Peripheral Blood Are as Risk Factors for Rheumatoid Arthritis.

Yang Guo,Jiayue Rao,Zikun Huang,Qing Luo,Lu Zhang,Junming Li,Yujie Gao

doi:10.1155/2020/5735279

Abstract

ALKBH5 (alkylation repair homolog protein 5), FTO (fat mass and obesity-associated protein), and RNA N6-methyladenosine (m6A) demethylase, are essential for the m6A mRNA modification. YTHDF2 (YT521-B homology domains 2) called m6A “readers” can recognize m6A modification. As the key enzymes of m6A methylation modification, ALKBH5, FTO, and YTHDF2 have been implicated in many diseases. However, little is known about the role of ALKBH5, FTO, and YTHDF2 in rheumatoid arthritis (RA). We measured the mRNA expression of ALKBH5, FTO, and YTHDF2 in RA patients and controls by quantitative real-time polymerase chain reaction, and the global m6A content was detected by an ELISA-like format. The mRNA expression of ALKBH5, FTO, and YTHDF2 in RA patients was further analyzed to investigate its correlations with disease activity. And, multivariate analysis (logistic regression) was used to analyze the risk factors. The mRNA expression of ALKBH5, FTO, and YTHDF2 in RA patients was significantly decreased compared to controls. The mRNA expression of ALKBH5 was significantly increased in RA patients that received regular treatment. The mRNA expression of FTO was associated with disease activity score 28 (DAS28), complement 3 (C3), immunoglobulin G (IgG), and lymphocyte-to-monocyte ratio (LMR), some common markers for RA disease activity. The mRNA expression of YTHDF2 was associated with RBC, L%, N%, NLR, and LMR. Furthermore, logistic regression analysis revealed that decreased expression of ALKBH5, FTO, and YTHDF2 in peripheral blood was a risk factor for RA. Moreover, the peripheral blood global m6A content was significantly increased in patients with RA compared to CON, and increased m6A contents negatively correlated with decreased mRNA expression of FTO. In conclusion, this study firstly demonstrates the critical role of ALKBH5, FTO, and YTHDF2 in RA, which provides novel insights into recognizing the pathogenesis of RA and a promising biomarker for RA.

Highlights

Rheumatoid arthritis (RA) is a chronic debilitating systemic autoimmune disease with permanent joint destruction, which is a highly disabling disease because of joint deformity and loss of function [1]
An independent cohort consisting of 59 rheumatoid arthritis (RA) patients and 41 CON was enrolled in the validation set for evaluation of abnormal genes
No correlation between the mRNA expression of alkB homolog 5 (ALKBH5), fat mass and obesity-associated protein (FTO), and YTHDF2 in the peripheral blood, and age or sex was observed in RA or CON

Summary

Introduction

Rheumatoid arthritis (RA) is a chronic debilitating systemic autoimmune disease with permanent joint destruction, which is a highly disabling disease because of joint deformity and loss of function [1]. Accumulating studies have shown that dysregulation of the immune system, including abnormal activation T and B lymphocytes, neutrophils, mast cells, and macrophages, is involved in the mechanisms that drive the onset of RA [4, 5]. The key enzymes for m6A methylation modification primarily include m6A methyltransferase (writer), m6A demethylase (eraser), and m6A RNA-binding proteins (reader) [10]. It has been demonstrated that the role of ALKBH5 and FTO may alter in different tissues and cells. The role of ALKBH5, FTO, and YTHDF2 in RA, an autoimmune and inflammatory disease, still needs to be explored. We investigate the expression of ALKBH5, FTO, and YTHDF2 in RA and its relationship with disease activity

Materials and Methods

F: TGCACCACCAACTGCTTAGC R

Results

Discussion

Conflicts of Interest