Abstract

Precise physiological and molecular marker-based assessment provides information about the extent of genetic diversity, which helps for effective breeding programmes. We have conducted detailed physiological and molecular marker-based assessment of selected eight indigenous rice landraces from Koraput, India along with tolerant (N22) and susceptible (IR64) check varieties under control and simulated drought stress using polyethylene glycol (PEG) 6000. After exposure to different levels of drought stress, relative germination performance (RGP), seedling vigour index (SVI) and relative growth index (RGI) were significantly declined in all the rice landraces compared to the control plants and significant varietal differences were observed. Genetic relationship among the studied rice landraces was assessed with 24 previously reported drought tolerance linked Simple Sequence Repeat (SSR) markers. A total of 53 alleles were detected at the loci of the 24 markers across the 10 rice accessions. The Nei's gene diversity (He) and the polymorphism information content (PIC) ranged from 0 to 0.665 and 0 to 0.687, respectively. Six SSR loci, RM276, RM411, RM3, RM263, RM216 and RM28199, provided the highest PIC values and are potential for exploring the genetic diversity of studied rice lines for drought tolerance. Four rice genotypes (Butkichudi, Haldichudi, Machakanta and Kalajeera) showed the highest genetic distance with tolerant check variety (N22) and can be considered as valuable genetic resources for drought breeding program.

Highlights

  • Plant materials and growth conditionsThe experiment was conducted by taking eight folk rice genotypes from Koraput, India along with N22 (drought-tolerant improved rice variety) and IR64 (drought-susceptible irrigated variety) as check varieties

  • Data on genetic potentiality of folk rice (Oryza sativa L.) genotypes from Koraput, India in reference to drought tolerance traits

  • Precise physiological and molecular marker-based assessment provides information about the extent of genetic diversity, which helps for effective breeding programmes

Read more

Summary

Plant materials and growth conditions

The experiment was conducted by taking eight folk rice genotypes from Koraput, India along with N22 (drought-tolerant improved rice variety) and IR64 (drought-susceptible irrigated variety) as check varieties. Uniform sized seeds of each variety were selected, surface sterilized and kept for germination. RGP: relative germination performance; RGI: relative growth Index; SVI: seedling vigour index. GTTACATCATGGGTGACCCC placed in sterilized petriplates over saturated tissue paper and transferred to an incubator with a 12h light/12-h dark photoperiod with daily maximum photosynthetic photon flux density (PPFD) about. After sowing seeds immediately the drought stress was simulated with variations in osmotic potential by application of different concentrations (19.6%, 29.6% and 36.0%) of polyethylene glycol (PEG) that produced À0.5, À1.0 and À1.5 MPa water potential, respectively for 15 days. A control set was run along with the treatment without application of PEG

Determination of early growth performances
Findings
Genotyping with drought tolerance linked rice microsatellite loci

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.