Abstract
This article describes data related to the research article titled “Functional characterization of importin α8 as a classical nuclear localization signal receptor” [1]. A GST pull-down assay showed that both importin α1 and α8, which are classical nuclear localization signal (cNLS) receptors, can form a dimer with importin α6, α7, or α8. Importin α8 has higher dimer-forming ability than importin α1. In addition, our data show that either importin α1 or importin α8 can form a heterodimer with importin α3, which exists in a preformed complex with cNLS substrates such as the conventional SV40TNLS or the p53 protein, resulting in the release of the cNLS substrates from importin α3.
Highlights
Laboratory of Nuclear Transport Dynamics, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8 Saito-Asagi, Ibaraki, Osaka 567-0085, Japan article info
A GST pull-down assay showed that both importin α1 and α8, which are classical nuclear localization signal receptors, can form a dimer with importin α6, α7, or α8
Our data show that either importin α1 or importin α8 can form a heterodimer with importin α3, which exists in a preformed complex with classical nuclear localization signal (cNLS) substrates such as the conventional SV40TNLS or the p53 protein, resulting in the release of the cNLS substrates from importin α3
Summary
The N-terminus FLAG-tagged cDNAs encoding full-length human importin α6 (KPNA5, NM_012316) or full-length human-importin α7 (KPNA6, NM_002269) were amplified from either HEK293 cells or MRK-nu-1 cells (JCRB Cell Bank, Osaka, Japan) by PCR using the following primers: importin α6 Forward: 50-CCCGAATTCCGCCATGGACTACAAGGACGACGACGACAAGATGGATGCCATGGCTAGTCC-30 and importin α6 Reverse: 50-CCCGCGGCCGCCTCGAGTTAAAGTTGAAATCCATCC-30 or importin α7 Forward: 50CCCGAATTCCGCCATGGACTACAAGGACGACGACGACAAGATGGAGACCATGGCGAGC-30 and importin α7. The PCR products were digested with EcoRI and NotI, and subcloned into the pGEX6P3 plasmid (GE Healthcare, Tokyo, Japan). The human-importin α8 (KPNA7, NM_001145715) cDNA with the FLAG-tag at the N-terminus was amplified by PCR from the pcDNA5/3xFLAG-h-importin α8 plasmid [1]. The PCR products were inserted into EcoRI and NotI sites of pGEX6P3, and sequenced using either the pGEX 50 or pGEX 30 sequencing primer and the importin α8 sequencing primer: 50-CAACATCGCTTCAGGGACTTCG-30. The human cDNA encoding the tumor protein p53 (NM_000546) was amplified from MCF7 cells by PCR performed using the following primers: p53 Forward: 50-CACGGATCCATGGAGGAGCCGCAGTCAGATC-30 and p53 Reverse: 50-GGACTCGAGTCAGTCTGAGTCAGGCCCTTCTG-30.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.