Abstract

The growth arrest-specific 2 (GAS2) was cloned and found to be upregulated in the feces of recurrent CRC patients. This overexpressed GAS2 induced different patterns of gene expressions in CRC cells. Briefly, one cell proliferation marker, Ki-67 antigen (Ki-67), was upregulated in the cells with overexpressed GAS2, “Correlation between proliferation markers: PCNA, Ki-67, MCM-2 and antiapoptotic protein Bcl-2 in colorectal cancer” [1]. Whereas, the expression of another cell proliferation marker, proliferating cell nuclear antigen (PCNA), changed insignificantly [1]. In addition, the mRNA level of one cyclin involving in both cell cycle G1/S and G2/M transitions was also not affected by GAS2 overexpression, “Cdc20 and Cks direct the spindle checkpoint-independent destruction of cyclin A” [2]. The experimental design and procedures in this article can be helpful for understanding the molecular significance of GAS2 in SW480 and SW620 CRC cells.

Highlights

  • The growth arrest-specific 2 (GAS2) was cloned and found to be upregulated in the feces of recurrent CRC patients

  • The mRNA level of one cyclin involving in both cell cycle G1/S and G2/M transitions was not affected by GAS2 overexpression, “Cdc20 and Cks direct the spindle checkpointindependent destruction of cyclin A” [2]

  • Chang et al / Data in Brief 8 (2016) 82–86 design and procedures in this article can be helpful for understanding the molecular significance of GAS2 in SW480 and SW620 CRC cells

Read more

Summary

Data accessibility

Filtered, analyzed CRC patients with different clinical status (recurrence and nonrecurrence) were enrolled. Fecal total RNA was purified from these CRC patients with different clinical status and microarray analyses were performed. Expression levels of certain genes in feces were different between CRC patients without and with recurrence. The data would be valuable to correlate the cell proliferation markers and the expression levels of GAS2. The data shared in this article are the experimental analyses of GAS2 expression in clinical samples, patient's feces, and CRC cell lines. The level of GAS2 would be up-regulated in the cases with recurrent CRC by microarray analysis (Fig. 1) [3]. The relative mRNA levels of interested genes (proliferating cell nuclear antigen: PCNA; Ki-67 antigen: Ki-67; cyclin A2: CCNA2) in different cells are presented in Figs. 2 and 3

Expression difference in feces of nonrecurrent and recurrent CRC patients
F: GCGATCGCGCTAGCATGTGCACTGCTCTGAGCCC R
The significance of GAS2 in cell proliferation
The correlation of GAS2 in the expression of CCNA2
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.