CSIG-03. SMALL RNA SEQUENCING OF GLIOBLASTOMA MULTIFORME EXTRACELLULAR VESICLES

Abstract

Glioblastoma (GBM) subverts the immune system towards immunosuppression through transfer of oncogenic components, including non-coding RNAs, via extracellular vesicles (EVs). GBM-derived EVs are detectable in blood and CSF and may one-day serve as liquid biopsies. EVs of 5 adult GBM cell lines generated at our institution from primary GBMs were harvested after serum-free culture and purified via sequential centrifugation. RNA was collected using the miRNAeasy kit (Qiagen) and sequenced with Illumina HiSeq 2000. Data was analyzed using the OASIS-2.0 platform using HG38. MirTarBase and MirDB interrogated validated and predicted microRNA-gene interactions. 712 of 28623 interrogated non-coding mi/pi/sno/sn/r-RNAs were expressed, most of which novel associations with GBM EVs. Hsa-miR-21-5p, hsa-let-7b-5p, hsa-miR-3182, hsa-miR-4448, hsa-let-7i-5p were most expressed; miRNAs and piRNAs combined generated 92-98% total expression. 10 miRNAs and 13 piRNAs constituted >50% total expression per RNA species per sample. The miRNA gene targeting profile was highly conserved and focused on PTEN, BCL2 and IGF1R, culminating in the silencing of cell cycle, PI3K/Akt, MAPK, p53 and Glioma KEGG pathways. MirDeep2 predicted 4 robustly expressed novel microRNAs with mature sequences aguggggccacgagcugaga, uagugguuaguacccugccuug, acagauugagagcucuuuu and auuucuguccaacuucug. Predicted gene targets of novel miRNAs closely overlapped those of validated miRNAs. Hierarchical clustering demonstrated dBT165 and dBT114 as a separate group based on total/mi/pi/r-RNA, and was predictive of >2 years survival. Hsa-miR-5585-3p (p-value: 0.04, fold-change: 2.8), hsa_piR_020365 (p-value:0.016, fold-change: 7, 17th highest overall expression), hsa_piR_008624 (p-value:0.017, fold-change: 3.6), as well as total hsa-mir-34 family expression (p-value: 0.018), total piRNA (p-value: 0.047) and snRNA (p-value: 0.035) expression were predictive of <2 years survival. We demonstrated expression of previously unassociated RNAs, including 4 novel miRNAs, and detailed clinical and prognostic relevance. Identification of non-coding RNAs and gene/pathway silencing analyses are of paramount importance for development of diagnostic and prognostic tools, providing pathophysiologic understanding, and, in the future, potentially direct decision-making.