Abstract
Relevance. Yersinia pseudotuberculosis is a causative agent of pseudotuberculosis, a disease with polymorphism of clinical manifestation that is determined by the presence of specific virulence determinants: plasmid pVM82, pathogenicity islands HPI and YAPI, and superantigen YPM. Occurrence of new determinants depends on horizontal transfer of mobile genetic elements, hence, systems regulating horizontal transfer participate in evolution of pathogenic species. CRISPR-Cas is and adaptive protection system of prokaryotes against mobile genetic elements. Aim. The study analyzed an interaction between CRISPR-loci of Y. pseudotuberculosis and virulence determinants. Results. 86% of strains includes three CRISPR-loci: YP1, YP2, and YP3. Length of locus YP3 mostly depends on presence of virulence determinants in strains of Y. pseudotuberculosis serotype O:1b. Strains with virulence genes are able to cause a severe form of pseudotuberculosis and have longer locus than strains without determinants. Conclusion. Therefore, CRIPSRCas system of Y. pseudotuberculosis may participate in formation of a certain strain genotype that defines clinical manifestation of pseudotuberculosis.
Highlights
ACATTGTGGTTATCGGTGGTCT CAGTAATAAAAGATGCCATTCTCCCTTGCGCTGCTAAAAGCGTTG CCCGATTCTTGTGACCCTCT GGATTCTTAGCCTATTCACA CGATCTCTGTTTTGTGGTGA для заболевания в европейских странах позволяют предположить возможное разнообразие состава CRISPR-систем штаммов, обнаруживаемых на территории нашей страны
К структурам прокариотических организмов, способным узнавать и уничтожать чужеродный генетический материал, относится система CRISPRCas
Loci of CRISPR-Cas system of Y. pseudotuberculosis strains with different genetic group
Summary
TTGCGCTGCTAAAAGCGTTG CCCGATTCTTGTGACCCTCT GGATTCTTAGCCTATTCACA CGATCTCTGTTTTGTGGTGA для заболевания в европейских странах позволяют предположить возможное разнообразие состава CRISPR-систем штаммов, обнаруживаемых на территории нашей страны. Цель настоящего исследования – aнализ локусного состава CRISPR-Cas-систем штаммов Y. pseudotuberculosis, выделенных на территории РФ, и определение взаимосвязи длины локусов от наличия факторов вирулентности, которые определяют полиморфизм клинических проявлений псевдотуберкулеза. ПЦР проводили по программе: 1 цикл 94 °С – 3 мин; 30 циклов амплификации 94 °С – 30 сек, 55 °С – 1 мин, 72 °С – 2 мин; 72 °С – 10 мин. Праймеры для амплификации CRISPR-локусов были разработаны с использованием онлайн-приложения NCBI Primer-BLAST на основе 15 полногеномных последовательностей систем штаммов Y. pseudotuberculosis, депонированных в базах данных GenBank и RefSeq NCBI Идентификацию CRISPR-систем в геномах штаммов Y. pseudotuberculosis проводили посредством онлайн-программ «CRISPRone» и «CRISPRFinder» [23,24]. ПЦР проводили по программе: 1 цикл 94 0С -3 мин; 25 циклов амплификации 94 °С – 45 сек, 48 °С – 45 сек, 72 °С – 4 мин; 72 °С – 10 мин. Loci of CRISPR-Cas system of Y. pseudotuberculosis strains with different genetic group
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
