Abstract
Synthetic oligodeoxynucleotides (ODN) that contain unmethylated CpG motifs (CpG ODN) induce macrophages to secrete IL-12, which induces interferon (IFN)-gamma secretion by natural killer (NK) cells. Since these cytokines can induce T helper 1 (Th1) differentiation, we examined the effects of coadministered CpG ODN on the differentiation of Th responses to hen egg lysozyme (HEL). In both BALB/c (Th2-biased) and B10.D2 (Th1-biased) mice, immunization with HEL in incomplete Freund's adjuvant (IFA) resulted in Th2-dominated immune responses characterized by HEL-specific secretion of IL-5 but not IFN-gamma. In contrast, immunization with IFA-HEL plus CpG ODN switched the immune response to a Th1-dominated cytokine pattern, with high levels of HEL-specific IFN-gamma secretion and decreased HEL-specific IL-5 production. IFA-HEL plus CpG ODN also induced anti-HEL IgG2a (a Th1-associated isotype), which was not induced by IFA-HEL alone. Control non-CpG ODN did not induce IFN-gamma or IgG2a, excepting lesser increases in B10.D2 (Th1-biased) mice. Thus, CpG ODN provide a signal to switch on Th1-dominated responses to coadministered antigen and are potential adjuvants for human vaccines to elicit protective Th1 immunity.
Highlights
We propose that CpG ODN function as adjuvants that switch on T helper 1 (Th1) responses, making them important candidate adjuvants for potential use in future human vaccines
Consistent with previous results demonstrating that incomplete Freund’s adjuvant (IFA) induces a Th2 response while CFA induces a Th1 response to antigen [6], mice injected with IFA-hen egg lysozyme (HEL) did not produce detectable IgG2a responses (Fig. 1 A)
To confirm the role of the CpG motif, we examined the effects of two additional pairs of CpG and non– CpG ODN
Summary
ODN were purchased from Operon Technologies (Alameda, CA) or Oligos Etc. ODN were phosphorothioate-modified to increase their resistance to nuclease degradation. ODN used in these studies are listed in Table 1 and their sequences are given here (CpG motifs or reversed non-CpG motifs are underlined). Sequences of ODN that were phosphorothioate-modified throughout (S ODN) are: CpG ODN 1826, TCCATGACGTTCCTGACGTT; non–CpG ODN 1745, TCCAATGAGCTTCCTGAGTCT; CpG ODN 1760, ATAATCGACGTTCAAGCAAG; non–CpG ODN 1908, ATAATAGAGCTTCAAGCAAG. Sequences of ODN phosphorothioate-modified on the ends only (S-O ODN) are: CpG ODN 1585, GGGGTCAACGTTGAGGGGGG; and non–CpG ODN 1972, GGGGTCTGTGCTTTTGGGGGG. The first two 5Ј end bonds and last five 3Ј end bonds of the S-O ODN are phosphorothioate-modified. Synthetic ODN were dissolved in TE (10 mM Tris, 1 mM EDTA). LPS content of ODN was Ͻ1 ng LPS/mg DNA, as measured by Limulus amebocyte assay (QCL-1000; BioWhittaker, Walkersville, MD)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have