Abstract

Journal of PhytopathologyVolume 169, Issue 4 p. 269-269 CORRIGENDUMFree Access Corrigendum This article corrects the following: Biocontrol of strawberry fruit infected by Botrytis cinerea: Effects on the microbial communities on fruit assessed by next-generation sequencing Andre Freire Cruz, Geleta Dugassa Barka, Justine Sylla, Annette Reineke, Volume 166Issue 6Journal of Phytopathology pages: 403-411 First Published online: March 23, 2018 First published: 15 March 2021 https://doi.org/10.1111/jph.12976AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Cruz, A. F., Barka, G. D., Sylla, J., & Reineke, A. (2018) Biocontrol of strawberry fruit infected by Botrytis cinerea: Effects on the microbial communities on fruit assessed by next-generation sequencing. Journal of Phytopathology, 166, 403–411. https://doi.org/10.1111/jph.12700 At the request of the corresponding author of the aforementioned article, part of the materials and methods (2.2) was modified as written below: Fragments of the bacterial 16S rRNA genes were amplified using the universal primer pairs 534f-CS1 (5'-CAGCAGCCGCGGTAAT-3') and 783r-CS2 (5'-ACCMGGGTATCTAATCCKG -3'), which are reliable to estimate bacterial abundances on plants as they exclude the mitochondria and chloroplast genes (Rastogi, Tech, Coaker, & Leveau, 2010). All primers contained their respective adapters, CS1 (ACACTGACGACATGGTTCTACA) and CS2 (TACGGTAGCAGAGACTTGGTCT) (Fluidigm Co., USA), to allow sequencing. Parts of the fungal ITS gene were amplified with the primers ITS1-CS1 (5'-CTTGGTCATTTAGAGGAAGTAA-3') and 5.8S-CS2 (5'-CGCTGCGTTCTTCATCG-3') (Buée et al., 2009). REFERENCE Cruz, A. F., Barka, G. D., Sylla, J., & Reineke, A. (2018). Biocontrol of strawberry fruit infected by Botrytis cinerea: Effects on the microbial communities on fruit assessed by next-generation sequencing. Journal of Phytopathology, 166, 403– 411. Wiley Online LibraryCASWeb of Science®Google Scholar Volume169, Issue4April 2021Pages 269-269 ReferencesRelatedInformation

Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call