Corrigendum to “Multilocus sequence typing of a dairy-associated Leuconostoc mesenteroides population reveals clonal structure with intragenic homologous recombination” (J. Dairy Sci. 98:2284–2293)

Abstract

The primer sequences for murC and murE in Table 1 (page 2285) were incorrect. The correct sequences (5′–3′) are as follows:murC_primerF: CCATTAGAGGCAGCAGGTA andmurC_primerR: GGTTTCAAAGAACGCAAGTmurE_primerF: GCCTTCTTGAATATCTCCC andmurE_primerR: CAGCGGTTAAATAAACTACATC Multilocus sequence typing of a dairy-associated Leuconostoc mesenteroides population reveals clonal structure with intragenic homologous recombinationJournal of Dairy ScienceVol. 98Issue 4PreviewLeuconostoc mesenteroides strains play an important role in food fermentation. In this study, 136 strains from different dairy products in China and Mongolia were examined by multilocus sequence typing of 9 housekeeping genes. In total, 82 polymorphic sites were detected among the 9 loci. The number of polymorphic nucleotide sites varied between 4 (dnaA) and 18 (uvrC), whereas the nucleotide diversity per site among the 9 genes varied from 0.00379 in dnaA to 0.01195 in uvrC, suggesting a relatively low level of sequence diversity. Full-Text PDF Open Archive